The oligonucleotide synthesis on solid support was performed on a 381A or 394 DNA synthesizer from Applied Biosystems (Foster City, CA, USA). Reactions under microwave activation were performed on an Monowave 300 system (Anton Paar, Graz, Austria). Solutions of Cap A, Cap B and iodide were purchased from Link Technologies as well as the commercial solid supports. Cap A: Acetic anhydride/pyridine/THF, 1:1:8, v/v/v; Cap B: 10% N-methylimidazole in THF; Oxidizer solution: 0.1 M iodide in THF/pyridine/H2O, 78:20:2, v/v/v. Detritylation solution: 3% trichloroacetic acid (TCA) in CH2Cl2 and dry CH3CN for DNA synthesis were purchased from Biosolve (Dieuze, France). Cy3-amidite was purchased from GE Healthcare. All oligoglycooligonucleotides were purified and analyzed by C18 reversed-phase HPLC (Macherey-Nagel, Nucleodur 100-3 C18 ec, 4.6 × 75 mm, 3 µM or Nucleodur 100-7 C18 ec, 8 × 125 mm, 7 µm) on an Ultimate 3000 system (Dionex, Sunnyvale, CA, USA) with a Reodyne (Rohnert Park, CA, USA) injector and a UV DAD 3000 detector. Oligonucleotides were dosed by UV-Vis spectrophotometry at 550 nm on a 300 Bio UV-Vis spectrophotometer (Varian Cary, Victoria, Australia).
394 dna synthesizer
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 394 DNA synthesizer is a laboratory instrument designed for the automated synthesis of oligonucleotides, which are short strands of DNA or RNA. It utilizes phosphoramidite chemistry to synthesize these molecules in a controlled and efficient manner.
Automatically generated - may contain errors
Lab products found in correlation
Terminal deoxynucleotidetransferase, by New England Biolabs (2 mentions)
Sep pak c18 cartridge, by Waters Corporation (2 mentions)
α 32p cordycepin 5 triphosphate, by PerkinElmer (2 mentions)
α 32p dctp, by PerkinElmer (2 mentions)
T4 polynucleotide kinase, by New England Biolabs (2 mentions)
T4 dna ligase, by New England Biolabs (2 mentions)
γ 32p atp, by PerkinElmer (2 mentions)
Ultimate 3000 system, by Thermo Fisher Scientific (1 mentions)
Dna synthesis reagents, by Glen Research (1 mentions)
α 32p dttp, by PerkinElmer (1 mentions)
Klenow exo, by New England Biolabs (1 mentions)
Xbridge c18 column, by Waters Corporation (1 mentions)
Polypak 2 cartridge, by Glen Research (1 mentions)
Avance 3 hd 500 mhz, by Bruker (1 mentions)
8 protocols using 394 dna synthesizer
1
Oligonucleotide Synthesis Using Solid Support
2
Oligonucleotide Preparation and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides
were
prepared on an Applied Biosystems Inc. 394 DNA synthesizer. Commercially
available DNA synthesis reagents were obtained from Glen Research
Inc. DNA substrates used in this study are presented in Chart1 . T4 polynucleotide kinase, terminal deoxynucleotide
transferase, and T4 DNA ligase were obtained from New England Biolabs.
[α-32P]dCTP, [γ-32P]ATP, and [α-32P]cordycepin 5′-triphosphate were purchased from PerkinElmer.
Analysis of radiolabeled oligonucleotides was conducted using a Storm
840 phosphorimager and ImageQuant TL. UvrABC was obtained as previously
described.36 (link),37 (link) C18-Sep-Pak cartridges were obtained
from Waters. Experiments using radiolabeled oligonucleotides were
analyzed following PAGE using a Storm 840 phosphorimager and Imagequant
TL.
were
prepared on an Applied Biosystems Inc. 394 DNA synthesizer. Commercially
available DNA synthesis reagents were obtained from Glen Research
Inc. DNA substrates used in this study are presented in Chart
transferase, and T4 DNA ligase were obtained from New England Biolabs.
[α-32P]dCTP, [γ-32P]ATP, and [α-32P]cordycepin 5′-triphosphate were purchased from PerkinElmer.
Analysis of radiolabeled oligonucleotides was conducted using a Storm
840 phosphorimager and ImageQuant TL. UvrABC was obtained as previously
described.36 (link),37 (link) C18-Sep-Pak cartridges were obtained
from Waters. Experiments using radiolabeled oligonucleotides were
analyzed following PAGE using a Storm 840 phosphorimager and Imagequant
TL.
3
Oligonucleotide Synthesis and Radiolabeling
4
Synthesis and Purification of Bpy-modified DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligodeoxynucleotides were synthesized on an Applied Biosystems 394 DNA synthesizer by standard phosphoramidite chemistry. The synthesis of the phosphoramidite derivative of Ubpy is presented in the ESI.† The DNA synthesis was carried out on a 1 μmol scale in DMTr-on mode with standard reagents purchased from Glen Research. The coupling time of the nucleosides was extended to 15 min. The products were deprotected in 25% NH3 solution at 55 °C for 8 h. The oligomers were firstly purified and detritylated using a PolyPak II cartridge (Glen Research) and further purified by reverse-phase HPLC (Waters XBridge C18 column, 0.1 M TEAA (pH 7.0)/MeCN gradient, 60 °C) (Fig. S1† ). All DNA strands were identified by MALDI-TOF mass spectrometry (see ESI† ). The amount of the oligomers was determined based on the UV absorbance at 260 nm. The molar extinction coefficients (ε260) of the bpy-modified DNA strands (L1 , L2 , and L3 ) were estimated15 by the sum of the ε260 value of the bpy group and that of corresponding unmodified oligonucleotides calculated by the nearest-neighbor method. Some of the unmodified oligonucleotides purified by HPLC were purchased from Japan Bio Services and used without further purification.
5
Mitochondrial rRNA Oligonucleotide Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study it was used the gene encoding the mitochondrial large-subunit of P. jirovecii (mt LSU rRNA). Design of oligonucleotides and in silico analysis is described in the Electronic Supplementary Information (Scheme S1) . Table 1 shows the sequences of the oligonucleotides employed in this study. The synthesis took place by the well-defined phosphoramidite solid phase protocol [32 (link)]. For this, oligonucleotides were assembled on controlled pore glass (CPG) scaffolds by consecutive incorporation of the suitable phosphoramidites employing an automated Applied Biosystems 394 DNA synthesizer (Foster City, CA, USA). Then, the scaffolds were treated overnight with concentrated ammonia at 55 °C. Finally, synthetized oligonucleotides were purified by Glen-PackTM DNA cartridges (Glen Research, Sterling, VA, USA) and mass spectrometry was used to analyze them (Table S1 , ESI).
6
Synthesis and Characterization of Oligonucleotide Conjugates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reagents and anhydrous solvents were purchased
from commercial sources and were used without any further purification.
Reaction progress for small-molecule work was monitored by thin-layer
chromatography (TLC) using aluminum sheet silica gel 60 F254 (Merck)
plates. Compounds were purified by column chromatography and/or RP-HPLC
as stated. Unless otherwise noted, mixtures of ethyl acetate and hexane
were used as the eluent for column chromatography. 1H,
D2O exchange, 13C{1H}, 135DEPT, and
2D NMR spectra were acquired on a Bruker Avance III HD 500 MHz NMR
instrument. Chemical shifts are reported in ppm (δ scale), and
coupling constant (J) values are reported in hertz
(Hz). Data are represented as singlet (s), broad singlet (brs), doublet
(d), doublet of doublet (dd), broad doublet (brd) and multiplet (m).
Structural assignments were made with additional information from
gCOSY, gHSQC, and gHMBC experiments.
Oligonucleotides and the
dimeric core structures were synthesized on a Applied Biosystems 394
DNA synthesizer and were characterized by HPLC-MS (Table S1 and Figure S2 ). All conjugation reactions were performed
in 20 mM Tris·HCl, 200 mM NaCl, pH 7.5 buffer at 25 °C.
Reaction progress for oligonucleotide work was monitored by HPLC-MS
spectroscopy.
from commercial sources and were used without any further purification.
Reaction progress for small-molecule work was monitored by thin-layer
chromatography (TLC) using aluminum sheet silica gel 60 F254 (Merck)
plates. Compounds were purified by column chromatography and/or RP-HPLC
as stated. Unless otherwise noted, mixtures of ethyl acetate and hexane
were used as the eluent for column chromatography. 1H,
D2O exchange, 13C{1H}, 135DEPT, and
2D NMR spectra were acquired on a Bruker Avance III HD 500 MHz NMR
instrument. Chemical shifts are reported in ppm (δ scale), and
coupling constant (J) values are reported in hertz
(Hz). Data are represented as singlet (s), broad singlet (brs), doublet
(d), doublet of doublet (dd), broad doublet (brd) and multiplet (m).
Structural assignments were made with additional information from
gCOSY, gHSQC, and gHMBC experiments.
Oligonucleotides and the
dimeric core structures were synthesized on a Applied Biosystems 394
DNA synthesizer and were characterized by HPLC-MS (
in 20 mM Tris·HCl, 200 mM NaCl, pH 7.5 buffer at 25 °C.
Reaction progress for oligonucleotide work was monitored by HPLC-MS
spectroscopy.
7
Oligonucleotides for Topoisomerase I and TDP1 Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides for construction of the S (hTopI) substrate, TDP1 substrate, and amino primer (p) were obtained from DNA Technology A/S, Aarhus, Denmark and synthesized using the 394 DNA synthesizer from Applied Biosystems. Oligonucleotide sequences were as follows:
S (TopI): 5’AGAAAAATTTTTAAAAAAACTGTGAAGATCGCTTATTTTTTTAAAAATTTTTCTAAGTCTTTTAGATC-CCTCAATGCACATGTTTGGCTCC-GATCTAAAAGACTT3’
RCA primer: 5′ Am-CCAACCAACCAACCAAATAAGCGATCTTCACAGT3’
TDP1 sensor: 6FAM-AAA GCA GGC TTC AAC GCA ACT GTG AAG ATC GCT TGG GTG CGT TGA AGC CTG CTT T-BHQ1, where 6FAM was attached to the DNA through a phosphothioate and to 3′BHQ1 through a phosphodiester linkage.
8
DNA Scaffold Construction and Labeling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Scaffold DNA M13mp18 was purchased from Bayou Biolabs. CNVK phosphoramidite was purchased from Glen Research. The DNA strands containing the CNVK were synthesized on an Applied Biosystems 394 DNA synthesizer. The remaining DNA strands were purchased from Integrated DNA Technology, Inc. The sticky-end strands were purified using denaturing polyacrylamide gel electrophoresis. The staples strands with dyes (cy3 and cy5) were purified by IDT using high-performance liquid chromatography.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!