To collect about 5 ml of peripheral venous blood, anticoagulated tubes containing ethylenediaminetetraacetic acid were utilized. Total RNA was recovered from peripheral blood mononuclear cells (PBMCs) after they had been separated using a lymphocyte separation medium. The cDNA was generated using a revert first-strand cDNA kit in accordance with the manufacturer’s instructions (Promega, USA). The resultant cDNA was amplified in an Applied Biosystem 7500 Real-Time PCR System using a 20 µl reaction mixture including SYBR Green PCR Master Mix (Roche, USA) and a SYBR Green PCR Master Mix (Roche, USA). Table 1 lists the primer pairs for FcγRs including FcγRIa, FcγRIb, FcγRIIa, FcγRIIb, FcγRIIc, FcγRIIIa, FcγRIIIb, and GAPDH. The fold changes in between patients and controls were expressed by the 2-∆∆CT method.
Sybr green pcr master mix
Manufactured by Roche
Sourced in United States, Switzerland, Germany, United Kingdom, Japan, China, Canada, France, Spain
SYBR Green PCR Master Mix is a ready-to-use solution for real-time PCR amplification and detection. It contains the necessary reagents, including SYBR Green I dye, for the quantification of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (211 mentions)
Trizol, by Thermo Fisher Scientific (66 mentions)
Lightcycler 480, by Roche (50 mentions)
Rneasy mini kit, by Qiagen (49 mentions)
Primescript rt reagent kit, by Takara Bio (28 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (27 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (23 mentions)
Lightcycler 480 real time pcr system, by Roche (18 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (17 mentions)
Lightcycler 480 system, by Roche (15 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (14 mentions)
Lightcycler 480 instrument, by Roche (12 mentions)
Quantitect reverse transcription kit, by Qiagen (12 mentions)
Rneasy kit, by Qiagen (12 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (11 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (11 mentions)
Cdna reverse transcription kit, by Thermo Fisher Scientific (11 mentions)
Lightcycler 480 2, by Roche (10 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (10 mentions)
Lightcycler, by Roche (10 mentions)
684 protocols using sybr green pcr master mix
1
Quantification of FcγR Expression
2
Quantification of Cardiac Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cardiomyocytes using TRIzol (Invitrogen) as previously described. cDNA was synthesized using the Transcriptor First Strand cDNA Synthesis Kit (Roche). The mRNA levels of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP) and β‐myosin heavy chain (β‐MHC) were quantified using SYBR Green PCR Master Mix (Roche) on an ABI‐7900 Real‐Time PCR Detection System. U6 and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) levels were used as references for miR‐200c and mRNA expression. Quantitative real‐time PCR (qRT‐PCR) was performed with the SYBR Green PCR Master Mix (Roche) to determine the levels of our genes of interest, calculated using the comparative quantification method (the expression levels of mRNA = 2–ΔΔCT). ΔCT = CT(target gene) − CT(GAPDH/U6), ΔΔCT = ΔCT(experimental group) − ΔCT(control group). The following primers sequences were used:
ANP forward 5′‐GGGAAGTCAACCCGTCTCAG‐3′ and reverse 5′‐CTTCGGTACCGGAAGCTGTT‐3′； BNP forward 5′‐TTCTGCTCCTGCTTTTCCTT‐3′ and reverse 5′‐GCCATTTCCTCTGACTTTTC‐3′； β‐MHC forward 5′‐GATGGTGACACGCATCAACG‐3′ and reverse: 5′‐CCATGCCGAAGTCAATAAACG‐3′； miRNA‐200c forward: 5′‐TGCGCTAATACTGCCGGGTAA‐3′ and reverse: 5′‐CCAGTGCAGGGTCCGAGGTATT‐3′ GAPDH forward: 5′‐CGCTAACATCAAATGGGGTG‐3′ and reverse: 5′‐TTGCTGACAATCTTGAGGGAG‐3′; and U6 forward 5′‐CGCTTCGGCAGCACATATAC‐3′ and reverse 5′‐AAATATGGAACGCTTCACGA‐3′.
ANP forward 5′‐GGGAAGTCAACCCGTCTCAG‐3′ and reverse 5′‐CTTCGGTACCGGAAGCTGTT‐3′； BNP forward 5′‐TTCTGCTCCTGCTTTTCCTT‐3′ and reverse 5′‐GCCATTTCCTCTGACTTTTC‐3′； β‐MHC forward 5′‐GATGGTGACACGCATCAACG‐3′ and reverse: 5′‐CCATGCCGAAGTCAATAAACG‐3′； miRNA‐200c forward: 5′‐TGCGCTAATACTGCCGGGTAA‐3′ and reverse: 5′‐CCAGTGCAGGGTCCGAGGTATT‐3′ GAPDH forward: 5′‐CGCTAACATCAAATGGGGTG‐3′ and reverse: 5′‐TTGCTGACAATCTTGAGGGAG‐3′; and U6 forward 5′‐CGCTTCGGCAGCACATATAC‐3′ and reverse 5′‐AAATATGGAACGCTTCACGA‐3′.
3
Quantifying NET Expression by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used a 7500 Real-Time PCR machine (Applied Biosystems, Foster city, CA, USA) to carry out real-time PCR, which contained 1 μl primers (10 μM), 50 ng cDNA and 10 μl of 2XSYBR Green PCR Master Mix (Roche) with a final 20 μl volume. Using GAPDH as internal controls, we standardized the data to GAPDH and calibrated the data with control cDNA. We calculated the relative expression ratio by using the 2−ΔΔCt method. The sequences of primers were depicted as follows: NET Primer F: 5′-GAGTGGCCTACGGAATCACC-3′; NET Primer R: 5′-TCAATGGTGCTGGACCTGAC-3′; GAPDH Primer F: 5′-GGGAAACTGTGGCGTGAT-3′; GAPDH Primer R: 5′-GGGTGTCGCTGTTGA-3′.
4
Transcriptional Regulation Study Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ERβ (ab3576), ERα (ab32063), TPH2 (ab184505), SERT (ab102048), and Histone3 (ab1791) antibodies were purchased from Abcam Company (Abcam, MA, USA); Ahi1 (sc-515382) and GR (sc-56851) antibodies were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA); a mouse estradiol ELISA kit was purchased from Cusabio Biological Engineering Co., Ltd. (Baltimore, MD, USA); 17β-estradiol was purchased from Sigma-Aldrich Company (St. Louis, MO, USA); a Transcriptor First Strand cDNA Synthesis Kit and 2XSYBR Green PCR Master Mix were obtained from Roche (Germany); and Lipofectamine 2000 was purchased from Invitrogen Corporation (San Diego, CA, USA). All secondary antibodies were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA, USA).
5
Quantitative RNA Expression Analysis Using Trizol and SYBR Green
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol LS (Invitrogen) solution was used for lysis of nasal mucosa, followed by RNAqueous™ Total RNA Isolation Kit (Thermo Fisher). The total RNA extracted was then measured by UV spectrophotometer, and D260/280 and D260/230 were calculated. Total RNA was subjected to RNA reverse transcription reaction using Promega reverse transcription kit in the following reaction system. 5xBuffer 5.0 µL, random primers 0.5 µL, total RNA 8.5 µL, 10 mM dNTP (Promega) 2.0 µL, RNase inhibitor (Promega) 0.5 µL, M-MLV (Promega) 1.0 µL to total volume to 20 µL, and after mixing, incubated at 42 °C for 60 min; then incubated at 85 °C for 10 min to inactivate reverse transcriptase. The real-time quantitative PCR reaction system is as follows: 5.0 µL of cDNA, 0.5 µL of forward primer and 0.5 µL of reverse primer, 10 µL of 2xSYBR GreenPCR MasterMix, 4.0 µL of ddH2O, and a total volume of 20 µL. The reaction conditions are as follows: 95 °C, 5 min; 95 °C for 15 S, 60 °C for 15 S, 72 °C for 30 S, a total of 40 cycles on Light Cycler TM PCR (Roche). The expression level of mRNA was calculated with 2−ΔΔCt.
6
Quantifying Mitochondrial DNA Copy Number
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated using the EasyPrep Genomic DNA Extraction Kit (TOOLS) following the manufacturer’s instructions. Mitochondrial DNA (mtDNA) copy number was quantified in 10 µl 2X SYBR Green PCR Master Mix (Roche) containing 5 µM forward and reverse primers, with approximately 10 ng DNA. mtDNA levels were assessed using primers against the mitochondrial gene, ND1, with telomerase reverse transcriptase (TERT) serving as a loading control. Gene expression quantification was based on the comparative cycle threshold (CT) (2−△△CT) method. The primer sequences were as follows: ND1: forward, 5′-ACCAT TTGCA GACGC CATAA-3′; reverse, 5′-TAAAT TGTTT GGGCT ACGG-3′; TERT: forward, 5′-CTAGC TCATG TGTCA AGACC CTCT-3′; reverse, 5′-GCCAG CACGT TTCTC TCGTT-3′.
7
Quantitative PCR Analysis of Germ Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was conducted by using 2X SYBR Green PCR Master Mix (Roche) with a Roche Light Cycler 480 II thermal cycler. A 10X dilution of the pre-amplified cDNA was used with the following program: 95°C for 5 min for pre-incubation, 40 cycles of [95°C for 10 s, 60°C for 10 s and 72°C for 10 s] for amplification and one cycle of [95°C for 5 s, 65°C for 1 min and continuous heating to 97°C] for melting curve, followed by cooling at 40°C for 30 s. The following genes were assayed using the indicated primer pairs: vasa (5’-CCAATACCATGCCCAAGACT-3’ and 5’-ACAAACCAAGTGCCTTCACC-3’); nanos (5’-CCCTGTCCTTATGGCCTACA-3’ and 5’-GTTGGGTAGCTGGTTGGTGT-3’); piwil1 (5’-CCACTTCTTTGCTCAGGTCTAC-3’ and 5’-GATACGTCCGGAGTTGATGTTT-3’); tdrd/118019 (5’-ATCCAGCCAGCAGTCCTCATCA-3’ and 5’-GACTGCTGCTCCACCATCTCTG-3’); gene model 130738 (5’-CCACCAGAGCATAGCCCTTGAG-3’ and 5’-GGCTGGATCCTGTTTGTGACTG-3’); tdrd/176882 (5’-GGCGAGACACGAGCGAAAAA-3’ and 5’-CGTCCGAAAACTGTAGCGTCAA-3’); gene model 126022 (5’-AGCCTTGTCCATCTTCATAGT-3’ and 5’-AGTGTGCCAACCGTCTGT-3’); gene model 68495 (5’-ACGCCGACGAGTGGTTTGA-3’ and 5’-TTGCCTTGGTTACGGTGACTGT-3’); gapdh (5’-AAATGGGCGGAAGCAGGTG-3’ and 5’-ACATCGGCGCATCAGCAGAG-3’); β-actin (5’-ACCCCGTGCTGCTGACTGAG-3’ and 5’-CATGGCTGGGCTGTTGAAGG-3’).
8
Antibodies and Reagents for Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ahi1 Rabbit Antibody and Hap1 Guinea pigs Antibody were described previously18 (link); GR antibody (sc-56851) and His-probe antibody (sc-53073) were obtained from Santa-Cruz Biotechnology Inc. (Santa-Cruz, CA, USA); LSD-1 (#2139), and Histone-3 (#4499) antibodies were from Cell Signaling Technology, Inc., (Danver, MA, USA);ubiquitin antibody was from Abcam, (ab134953,Cambridge, MA, USA), Beta-tubulin antibody, anti-beta-actin antibody, imipramine (IM), mifepristone (RU 38486), fluoxetine, MG132, and dexamethasone acetate (Dex) were from Sigma-Aldrich Company (St. Louis, Missouri, USA); RPMI-1640 and FBS (Gibco Company, MD, USA); ECL chemiluminescence system was from Thermo Company (West Chester, PA, USA); Mouse corticosterone ELISA kit was purchased from Cusabio Biological Engineering Co. LTD (Baltimore, MD, USA); Transcriptor First Strand cDNA Synthesis Kit and 2XSYBR Green PCR Master Mix (Roche, Germany); Lipofectamine 2000 was bought from Invitrogen Corporation (San Diego, CA, USA). All secondary antibodies were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA, USA).
9
Quantifying Aldehyde Dehydrogenase Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 10 μl reaction volume consisted of 1.0 μl normalized cDNA, 5 μl 2X SYBR green PCR master mix (Roche Diagnostics GmbH, Germany) and 0.4 μl of 10 mM primer for each primer pair. Reactions were run in triplicate in a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, United States). Amplification conditions were 50°C for 2′, 95°C for 2′, 40 cycles of denaturing at 95°C for 10″ and a combined annealing and extension step at 55°C for 30″, followed by a disassociation stage from 55 to 95°C (melting curve analysis). The comparative threshold cycle (ΔΔCt) method was used to quantify the relative expression levels. Primers used were (forward and reverse): ALDH2a 5′TCTTCTTCAACCAGGGGCAA3′, 5′TGGCCTTCTCCACGAACTC3′, and ALDH2b 5′TTGAACAGGGCCCTCAGATT3′, 5′TAATCTGTCGCCACCAGTCA3′.
10
Real-time PCR for H. pylori Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the presence of H. pylori and its virulence genes, real-time PCR was performed. DNA extracted from saliva and gastric biopsies samples was used as template in the amplification reactions. Real-time PCR was performed in accordance with the manufacturer's protocol in a final volume of 20 µl, containing cDNA template, 2X SYBR Green PCR Master Mix (Roche Applied Science, Mannheim, Germany), and 5 pmol of each primer using a LightCycler® 480 Instrument (Roche Diagnostics, Neuilly sur Seine, France). The PCR primers for 16s RNA, cagA, vacA, and ureA (Integrated DNA Technologies, Coralville, IA, USA) are shown in Table 1 . The PCR conditions were as follows: 95°C for 10 minutes, then 40 cycles of 95°C for 15 s and 60°C for 1 minute. All data were analyzed using LightCycler 480 software, version 1.5 (Roche Diagnostics).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!