Primary OCs were cultured in complete medium containing DMEM/F12 1:1 medium, 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Waltham, MA), 10 ng/mL HGF (PeproTech, Rocky Hill, NJ), 20 ng/mL EGF (PeproTech), 20 ng/mL bFGF (PeproTech), Insulin-Transferrin-Selenium-Ethanolamine (ITS-X, Thermo Fisher Scientific), 50 μg/mL Dexamethasone (Sigma-Aldrich, St. Louis, MO), 20 μM rho-associated protein kinase inhibitor-Y27632 (Sigma-Aldrich), 1% vol/vol Penicillin-Streptomycin (Thermo Fisher Scientific). Primary HSCs were cultured in DMEM (Thermo Fisher Scientific) supplemented with 10% heat-inactivated FBS, 1% Penicillin/Streptomycin, 2 mM L-Glutamine (Thermo Fisher Scientific), 1 mM sodium pyruvate (Thermo Fisher Scientific), and 10 mM HEPES (Thermo Fisher Scientific). The immortalized murine HSC cell line, JS1 cell, was kindly provided by Professor Scott L. Friedman (Department of Medicine, Mount Sinai School of Medicine, New York) and Dr. Jinsheng Guo (Zhongshan Hospital, Shanghai Medical College, Fudan University, Shanghai, China). JS1 cells were cultured with DMEM supplemented with 10% heat-inactivated FBS, 1% Penicillin/Streptomycin, 2 m L-Glutamine, 1 mM sodium pyruvate, and 10 mM HEPES. Etoposide was purchased from Sigma-Aldrich. DMNB was purchased from Millipore. Laminin was purchased from Sigma-Aldrich.
Rho associated protein kinase inhibitor y27632
Manufactured by Merck Group
Sourced in United States
Rho-associated protein kinase inhibitor-Y27632 is a chemical compound that functions as a selective inhibitor of Rho-associated protein kinases (ROCK). It is commonly used as a research tool in cellular and molecular biology studies.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Laminin, by Merck Group (1 mentions)
Sodium pyruvate, by Thermo Fisher Scientific (1 mentions)
Basic fibroblast growth factor (bfgf), by Thermo Fisher Scientific (1 mentions)
Insulin transferrin selenium ethanolamine its x, by Thermo Fisher Scientific (1 mentions)
Hepes, by Thermo Fisher Scientific (1 mentions)
Epidermal growth factor (egf), by Thermo Fisher Scientific (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Hepatocyte growth factor (hgf), by Thermo Fisher Scientific (1 mentions)
Etoposide, by Merck Group (1 mentions)
Dexamethasone (dex), by Merck Group (1 mentions)
Gibco psc neural induction medium, by Thermo Fisher Scientific (1 mentions)
Accutase, by Thermo Fisher Scientific (1 mentions)
3 protocols using rho associated protein kinase inhibitor y27632
1
Optimized Culture Conditions for Primary and Immortalized Hepatic Stellate Cells
2
Generating Neural Progenitor Cells from iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
iPSCs cultured in feeder-free conditions were passaged to six-well plates at a density of 2.5 × 104 cells/cm2. Twenty-four hours after splitting, the culture medium was switched to Gibco PSC neural induction medium (Life Technologies) containing neurobasal medium and Gibco PSC neural induction supplement. After day 7 of induction, pNSCs were dissociated using Accutase (Life Technologies) and plated on Geltrex-coated dishes at a density of 1 × 105 cells per cm2 in NSC expansion medium containing 50% (v/v) neural basal medium, 50% (v/v) advanced DMEM/F12, and 1× neural induction supplement. Before the fourth passage, cells were treated overnight with 5 μM Rho-associated protein kinase inhibitor, Y27632 (Sigma-Aldrich), which was added to the neural expansion medium at the time of NSC plating. Culture medium was replaced every other day, or every day depending on cell expansion.
3
Generation of GFP-Luciferase-Expressing hiPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hiPSCs, generated as we previously reported [30 (link)], were used to generate GFP+ hiPSCs with the CRISPR/Cas9 system to insert a GFP-T2A-luciferase sequence into the genomic safe harbor AAVS1 site as previously reported [31 (link)]. Briefly, the sequence “CACCGGGTCTTCGAGAAGACCTGTTT” was inserted into BbsI restriction site of pX459 (#48139) to construct pX459-AAVS1. The sequence between SalI and MluI of pAAVS1-CAG-hrGFP (#52344) was replaced with GFP-T2A-luciferase sequence to construct a pAAVS1-CAG-GFP-T2A-Luc vector. The hiPSCs were nucleofected with the pX459-AAVS1 and pAAVS1-CAG-GFP-T2A-Luc plasmids. Then the hiPSCs were selected with puromycin at 48 h post-nucleofection, and selected 5000 cells were re-plated in a 10 cm dish supplemented with Rho-associated protein kinase inhibitor Y-27632 (Sigma-Aldrich, Carlsbad, USA) to maintain cell viability. About 2 weeks later, the single cell-derived clones were large enough to be picked and then amplified. The hiPSCs expressing GFP were confirmed by puromycin selection, immunocytochemical staining and flow cytometry analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!