Cdna synthesis kit

The miRNAeasy Mini Kit (QIAGEN 217004) was employed to harvest RNA following treatments. Following capture of the RNA, reverse-transcription was performed (cDNA synthesis kit (Quantabio 101414-106)). The SYBR green Real time PCR (RT-PCR) reagents kit (Quantabio 101414-276) was utilized as the reaction mix. The settings for the RT-PCR machine (Quantabio) are as follows—95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s. The fold changes were calculated based on 18S in the threshold cycle (Cq). Pertinent primer sequences are indicated in Table 1.

Total RNA was extracted from the polyps of similar size from the distal colon of each mouse using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and qPCR was performed using cDNA generated from 1 µg of total RNA with a cDNA synthesis kit (Quantabio, Beverly, MA, USA). qPCR reactions were carried out on 20 ng cDNA per reaction using n SYBR Green PCR master mix (Quantabio, Beverly, MA, USA) using a step-one (Thermo Fisher, Waltham, MA, USA) analysis system. Relative expression values were quantitated using the comparative cycle threshold method and normalized to mouse β-actin. The following primers were used:
Primer Sequence 5′-3′β-actin_FGTCACCCACACTGTGCCCATCβ-actin_RCCGTCAGGCAGCTCATAGCTCIL-6_FCCGGAGAGGAGACTTCACAGIL-6_RGGAAATTGGGGTAGGAAGGAArg1_FTTGGGTGGATGCTCACACTGArg1_RTTGCCCATGCAGATTCCCIL-17_FACCGCAATGAAGACCCTGATIL-17_RTCCCTCCGCATTGACACACD8_FCCGTTGACCCGCTTTCTGTCD8_RCGGCGTCCATTTTCTTTGGAA

For the mRNA determination of leptin and adiponectin in the WAT and that of UCP1, UCP2 and UCP3 in the BAT, samples from P20 were used, but not those from P8 or P14 due to inadequate tissue amount. Total RNA was extracted from tissue samples using Trizol (Invitrogen, Waltham, MA) and cDNA was prepared by using cDNA synthesis kit (QuantaBio, Beverly, MA). The equivalent of 1 μg RNA, as cDNA, was used for real-time qPCR analysis. The primers designed to detect the mRNA expression were as follows: Leptin (NM_013076.3), 5′-TCTCCGAGACCTCCTCCATCT-3′ (forward), and 5′-TTCCAGGACGCCATCCAG-3′ (reverse); Adiponectin (NM_144744.3), 5′-AAAATGTGGACCAGGCCTCT-3′ (forward) and 5′-TTGTCCCCTTCCCCATACAC-3′ (reverse); UCP-1 (NM_012682.2), 5′-AGAAGGATTGCCGAAACTGTAC-3′ (forward) and 5′-AGATCTTGCTTCCCAAAGAGG-3′ (reverse); UCP-2 (NM_019354.3), 5′-CCACAGCCACCGTGAAGTT-3′ (forward) and 5′-CGGACTTTGGCGGTGTCTA-3′ (reverse); UCP-3 (NM_013167.2), 5′-TGCTGAGATGGTGACCTACG-3′ (forward) and 5′-AGTGACAGGGGAAGTTGTCAG-3′ (reverse). β-actin was used as the housekeeping gene. The 2^−ΔΔCT method was used to compare the relative mRNA expression among groups^{(31 (link))}.

The expression of the putative TA systems was determined under various environmental stress conditions using real‐time polymerase chain reaction (PCR). Cells were grown to mid‐exponential phase in chemically defined medium supplemented with 20 mm glucose or 20 mm lactate30 at 37°C and were then exposed to various environmental conditions for 20 min. Environmental conditions examined included: acidic pH (pH 5.0), oxidative stress (0.1% hydrogen peroxide), microaerophilic conditions (5% CO₂), elevated temperature (39°C), anaerobic conditions (10% H₂, 10% CO₂, 80% N₂), iron limitation (250 μm bipyridyl), and reduced temperature (30°C). Bacteria were harvested and RNA was isolated using the cesium chloride step‐gradient method as described by Reddy and Gilman.31 RNA was reverse transcribed to cDNA using random primers provided in the cDNA synthesis kit (Quanta Bio, Beverley, MA), and the resulting cDNA was used in SYBR Green real‐time PCR using primers for the TA system as recommended by the manufacturer (Quanta Bio). Data were analyzed using the ΔΔCt method and fold change expression was determined by normalizing the results to the levels of an unstressed control (5S rRNA was used for normalization). The putative TA systems that are co‐expressed with a third gene (D11S_0469‐470 and D11S_2094‐2095) were excluded in these analyses.

Total RNA from naïve and memory CD25⁻Va2⁺CD4⁺ cells were isolated with RNeasy (Qiagen). Complementary DNA was synthesized using a cDNA synthesis kit (Quantabio) according to the manufacturer’s instruction. Expression of Il-2, Ifng, Il-4, or Il-13 mRNA was measured using a commercial primer/probe set (Life Technologies, Mm00434256_m1 Il2; Mm01168134_m1 Ifng, Mm00445259_m1 Il4, Mm00434204_m1 Il13). Quantitative PCR was performed using a 7900HT Fas Real-Time PCR system (Applied Biosystems) with the following cycles: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. Relative expression was normalized to β2μ (IDT, Mm.PT.39a.22214835).

Total RNA was extracted from the papillomas of similar size of each mouse using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and qPCR was performed using cDNA generated from 1 µg of total RNA with a cDNA synthesis kit (Quantabio, Beverly, MA, USA). qPCR reactions were carried out on 20 ng cDNA per reaction using SYBR Green PCR master mix (Quantabio, Beverly, MA, USA) using a Step-One (Thermo Fisher, Waltham, MA, USA) analysis system. Relative expression values were quantitated using the comparative cycle threshold method and normalized to mouse β-actin. For the evaluation of CB2 expression in ventral skin (non-exposed) compared to exposed skin, β-2-microglobulin (β2M) was used as the housekeeping gene. The following primers were used in Table 1.