Am17100

Primers and siRNAs were designed using the Primer3 and Thermofisher design portals respectively. uc.110 forward primer sequence is 5’-CAGCCAAAGGGGAAGTGTAT-3’, and the reverse sequence is 5’-CCGTCCTCCCTGCACTAAAT-3’.
MFRP forward primer sequence is 5’-GCATCTATTCATGTGGCAGGC-3’, and the reverse sequence is 5’-TACTCCGGACCCTCCAGTTG-3’.
The miR-544 precursor was ordered from Invitrogen (#.AM17100). Negative control oligos were ordered from Ambion (#.AM4635).

miR-148b depleted 4175-TGL expressed a specific miR-148bsponge with sequences designed to contain eight miRNA binding sites interrupted by 15-nts spacers to be perfectly complementary to the miR-148b seed region, with a bulge position 9–12 to prevent undesired cleavage of the sponge RNA as previously described in Penna et al [21 (link)]. Briefly, sponges were synthesized by DNA 2.0, cloned into pJ241 plasmids, excised using flanking HindIII sites, blunted and subcloned into blunted BamHI and SalI sites, downstream of EGFP into pLenti CMV-GFP-Puro (658–5) vector (Addgene), giving rise to pLenti148-spongeA/B. miR-148b depleted 4175-TGL were generated via lentiviral infection as described in Orso, Quirico et al 2016 [22 (link)]. For transient transfections, Anti-miR^™ Inhibitors (AM 17000), including a scrambled miRNA negative control (AM 17100) (Invitrogen Life Technologies), were used. MDA-MB-231 cells were seeded in 6-well plates at 50% of confluency and immediately transfected using HiPerFect Transfection Reagent (QIAGEN, Stanford, CA), anti-miR and Opti-Mem I medium, as instructed. The cells were incubated at 37 °C in a CO2 incubator for 24 h, and the medium was replaced with fresh normal growth medium.

MicroRNA miR-212 mimics with sequence UAACAGUCUCCAGUCACGGCC (AM17100) and negative control (NC) (AM17110) were purchased from Invitrogen. Anti-miR-212 (miRCURY LNA microRNA 212 inhibitor: 410138-04) was from Exiqon (Woburn, MA) and FLAG-tagged SIRT1 expression vector (EX-U1443-M11) from Genecopoeia (Rockville, MD). For transfections, the cells at 50-60% confluence were transfected with miR-212 mimic or inhibitor (50 nM) and NC (50 nM) by using lipofectamine 2000 (Invitrogen).

MiRNA-765 mimic (AM17100 ThermoFisher), and pre-miR-negative control scramble (AM17110 ThermoFisher) were transfected in SKOV3 cells using siPORT amine transfection agent. Briefly, miR-765 (80 nM) and scramble (80 nM) were individually added to wells containing 1 × 10⁴ cells cultured in DMEM for 48 h. Then, overexpression of miR-765 was confirmed by quantitative RT-PCR at 48 h postransfection using total RNA. MiR-765-expressing cells were used for downstream analysis.

22Rv1, PC-3, LNCaP, and HeLa cells (ATCC, Manassas, VA, USA) were maintained in recommended culture conditions. For esiRNA and pre-miRNA transfections, cells were reverse transfected with 20 nM of the targeting molecules using INTERFERin® transfection reagent (Polyplus Transfection SA, Illkirch, France) and following the manufacturer´s recommended transfection conditions and incubated for the indicated times. esiRNA targeting PDK4 (heterogeneous pool of siRNA of natural RNA; Mission® esiRNA) was obtained from Merck KGaA (Darmstadt, Germany; EHU007651), and Mission® esiRNA targeting GFP (EHUEGFP) and siRNA targeting Firefly Luciferase (AM4629, Ambion, Thermo Fisher Scientific) were used as controls. miRNAs targeting miR-32-3p and -5p (Pre-miR miRNA Precursor, AM17100) were obtained from ThermoFischer Scientific (pre-miR-32-3p ID: PM12716; pre-miR-32-5p ID: PM12584), and Pre-miR^TM Negative Control (AM17110) was used as control. Plasmid transfections were performed using FuGENE® HD Transfection Reagent (Promega, Madison, WI, USA) with 100 ng of plasmid with 3:1 ratio of transfection reagent to DNA using the manufacturer’s recommended transfection conditions. Co-transfections were performed using Dharmacon^TM DharmaFECT^TM Duo Transfection reagent (Perkin Elmer, Inc., Waltham, MA, USA) with 20 nM miRNA and 100 ng plasmid using the manufacturer’s recommended transfection conditions.

Twenty-four hours after cell seeding, cells were transfected with pre-miR-199a-3p mimic or with nonspecific control miRNAs (SCR) (30 nm) (assays #AM17100 and #AM17110; Thermo Scientific) using a TransIT-X2 Dynamic Delivery System (Mirus, Madison, WI, USA). The expression level of miR-199a-3p was determined by qPCR up to 48 h after transfection. Functional studies were performed as previously described for the CD99neg- and CD99pos EXO treatments.
In parallel, from the transfected TC-71 cells, EXOs enriched for miR-199a-3p were harvested and used for biological assays in TC-71 cells and CD99-deprived cells, TC-CD99-shRNA. The experiments performed reproduce the setting previously described in this section of material and methods.