Rimescript rt reagent kits

Normal human hepatic cell line LO2, human hepatocellular carcinoma cell lines SMMC-7721, HepG2 and Hep3B were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). All cells were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin–streptomycin at 37 °C with 5% CO₂. Total RNAs were isolated by using TRIzol (Invitrogen) and reverse transcription was performed with 1 μg of total RNA using rimeScript RT reagent kits (TAKARA Biotechnology, Dalian, China) following with the manufacturer's instructions, respectively. SYBR Green PCR master mix was employed for mRNA quantification. GAPDH was used as a control gene, and primer sequences of ATF3 as follows: forward, 5′- CCTCTGCGCTGGAATCAGTC -3′, reverse, 5′-TTCTTTCTCGTCGCCTCTTTTT-3′.

Total RNA was extracted from the NCSCs and pooled DRGs isolated from the thoracic and lumbar levels using RNeasy MICRO Kit (Qiagen). RNA samples were subsequently used for cDNA synthesis using rimeScript RT Reagent Kits (Takara). For quantitative PCR reactions on cDNAs, PowerUp SYBR Green Master Mix (Thermo Fisher Scientific, Japan) was used together with gene-specific primers (see Table S5).