Pdest27

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PDEST27 is a laboratory equipment product manufactured by Thermo Fisher Scientific. It is a high-precision device designed for various laboratory applications. The core function of the PDEST27 is to perform precise measurements and data analysis tasks, but a detailed description of its intended use is not available.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Anti 53bp1, by Novus Biologicals (1 mentions) Anti trim28, by Abcam (1 mentions) Anti histone h3, by Abcam (1 mentions) Mouse monoclonal anti tubulin, by Merck Group (1 mentions) Anti h3k9me3, by Abcam (1 mentions) Anti trf2, by Merck Group (1 mentions) Anti γh2ax, by Merck Group (1 mentions) Anti ha, by Merck Group (1 mentions) Anti gapdh, by ABclonal (1 mentions) Pet28a, by Thermo Fisher Scientific (1 mentions) Plko 1 vector, by Addgene (1 mentions) Pcdna dest47, by Thermo Fisher Scientific (1 mentions) Pcdna dest53, by Thermo Fisher Scientific (1 mentions) Pegfp actin, by Takara Bio (1 mentions) Denaturing loading buffer, by Thermo Fisher Scientific (1 mentions) Glutathione sepharose beads, by Cytiva (1 mentions) Complete protease inhibitor cocktail, by Roche (1 mentions) Jetprime, by Polyplus Transfection (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)

10 protocols using pdest27

Characterizing TRIM28 Expression and Function

Check if the same lab product or an alternative is used in the 5 most similar protocols

The U2OS, Wi38-VA13 and HEK293T cells were cultured in dulbecco's modified eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and cultured in an incubator containing 5% CO2 at 37 ℃. Human full-length TRIM28 cDNA was cloned into pDEST27 (Invitrogen) with GST tag and Plenti-HAFL-puro with HA-Flag (HAFL) double tags.
Cells were infected with lentivirus corresponding to shRNAs or overexpression vectors and selected with puromycin. Sense and antisense DNA oligos designed according to siRNA sequences were synthesized and cloned into pLKO.1-GFP vector. The siRNA sequences are: siTRIM28-1, 5′-CCUggCUCUgUUCUCUgUCCU-3′; siTRIM28-2, 5′-CUgAgACCAAACCUgUgCUUA-3′; siLuci, 5′-CUUACGCUGAGUACUUCGA -3′.
Antibodies used in this study include: rabbit polyclonal anti-TRIM28 (Abcam), rabbit polyclonal anti-Flag (Abmart), mouse monoclonal anti-tubulin (Sigma), rabbit polyclonal anti-GAPDH (Abmart), rabbit polyclonal anti-53BP1 (Novus), rabbit polyclonal anti-GST (Abmart), mouse monoclonal anti-PML (Millipore), rabbit polyclonal anti-Histone H3 (Abcam), rabbit polyclonal anti-H3K9me3 (Abcam) and rabbit polyclonal anti-SETDB1 (Proteintech).

Wang C., Songyang Z, & Huang Y. (2021). TRIM28 inhibits alternative lengthening of telomere phenotypes by protecting SETDB1 from degradation. Cell & Bioscience, 11, 149.

+ Open protocol

+ Expand

Characterization of HP1BP3 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cells were cultured in DMEM supplemented with 10% fetal bovine serum and 100 units/ml penicillin/streptomycin at 37°C and 5% CO₂. Human full-length HP1BP3 cDNA was cloned into pDEST27 (Invitrogen) for GST tagging and pHAGE-based vectors for Flag tagging (Addgene). pET-MBP-His6-based vectors were for MBP tagging (Addgene). HP1 α cDNA was cloned into pHAGE-based vectors for Flag tagging (Addgene). Histone H1C recombinant protein was purchased from company (Sigma, H1917). Cells were reverse transfected with siRNAs for 48–72 h before analysis. The siRNA sequences are:
Antibodies used in the study include: rabbit polyclonal anti-HP1BP3 (generated in the lab), rabbit polyclonal anti-Flag (Sigma, F7425), anti-HA (Sigma, H3663), anti-GAPDH (ABclonal, AC027), anti-TRF2 (Millipore, 05-521), anti-γH2AX (Millipore, 05-636), rabbit polyclonal anti-GST (Abmart, M20007), mouse monoclonal anti-PML (Santa Cruz, sc966), rabbit polyclonal anti-Histone H3 (Abcam, ab1791), rabbit polyclonal anti-H3K9me3 (Abcam, ab8898) and rabbit polyclonal IgG (Millipore, 12-370). Monoclonal anti-TIN2 antibodies were generated in the Songyang lab.

Shi G., Hu Y., Zhu X., Jiang Y., Pang J., Wang C., Huang W., Zhao Y., Ma W., Liu D., Huang J, & Songyang Z. (2020). A critical role of telomere chromatin compaction in ALT tumor cell growth. Nucleic Acids Research, 48(11), 6019-6031.

+ Open protocol

+ Expand

Cloning and Tagging of Rheb, ATP6AP1, and TRF1

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNAs encoding WT and mutant Rheb and ATP6AP1 were cloned into bacterial expression vectors for N-terminal GST or His tagging (pDEST27 and pET28a, Invitrogen), and eukaryotic expression vectors for N-terminal tagging with Flag-HA (pLenti-FLHA) or C-terminal tagging with SFB (S-tag, Flag and streptavidin-binding protein) (pLentiSFB).
cDNAs encoding various biotin ligases were cloned into the pcDNA3.1 vector for C-terminal Flag-HA tagging. TRF1 cDNA sequences were fused to cDNAs encoding various biotin ligases through a G4S linker and cloned into the pLenti vector for N-terminal HA-Flag tagging. Biotin ligases fused to a nuclear localization sequence were used as negative controls. All the constructs in this study have been sequence verified by Sanger sequencing. The pLKO.1 vector (#32682, Addgene) was used to clone the following shRNA sequences.
shNC: CCTAAGGTTAAGTCGCCCTCG;
shATP6AP1-1: GCATTGAGGATTTCACAGCAT;
shATP6AP1-2: TGCAGCTCTCTACCTACTTAG;
shATP6AP1-3: ACAGTGACATTCAAGTTCATT;
shATP6AP1-3′-UTR: TAAGAAGTACACGGGTTTATT.

Feng R., Liu F., Li R., Zhou Z., Lin Z., Lin S., Deng S., Li Y., Nong B., Xia Y., Li Z., Zhong X., Yang S., Wan G., Ma W., Wu S, & Songyang Z. (2024). The rapid proximity labeling system PhastID identifies ATP6AP1 as an unconventional GEF for Rheb. Cell Research, 34(5), 355-369.

+ Open protocol

+ Expand

Cloning and Tagging of MCRK and ROCK Constructs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

pEGFP-actin was purchased from Clontech. Full-length MRCKα WT and MRCKβ kinase domain (KD) were provided by the T. Leung laboratory, Institute of Molecular and Cell Biology, A-STAR, Singapore (Leung et al., 1998 (link); Tan et al., 2001 (link)). Full-length MRCKα and all the derived constructs (MRCKα 1–478, MRCKα 1–478 KD, MRCKα 1–965, MRCKα 1–965 KD, and MRCKα D478A) were cloned into pDONR/zeo using Gateway BP Clonase as previously described (Gagliardi et al., 2014 (link)). ROCK1 and ROCK2 constructs were cloned from full-length coding sequences provided by J. Herskowitz (University of Alabama at Birmingham, Birmingham, AL; Swanger et al., 2016 (link)). From pDONR/zeo, the constructs were transferred through Gateway LR Clonase in the following destination vectors: pcDNADEST47 (C-Term GFP), in pcDNA-DEST53 (N-Term GFP), in pcDNA-C-mCherry (C-term mCherry), and in pDEST27 (GST-N-Term Tag), all from Invitrogen.
Dual-tagged (GST and GFP) constructs for screening of caspase-cleavage sequences were prepared as follows: GFP was amplified by PCR using primer couples for the BP Gateway reaction, where each forward primer includes one sequence coding for the polypeptides to be tested for caspase-cleavage (eight amino acids, six preceding the putative cleavage site and two after). Once obtained by cloning in pDONR/zeo, constructs were moved in pDEST27 (GST-N-Term Tag).

Gagliardi P.A., Somale D., Puliafito A., Chiaverina G., di Blasio L., Oneto M., Bianchini P., Bussolino F, & Primo L. (2018). MRCKα is activated by caspase cleavage to assemble an apical actin ring for epithelial cell extrusion. The Journal of Cell Biology, 217(1), 231-249.

+ Open protocol

+ Expand

Co-Affinity Purification of Protein Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

To perform co-affinity purification experiments, ORFs encoding NS4 and WTAP or fragments, or CCHCR1 were transferred from pDONR207 to either pDEST27 (Invitrogen) or pCI-neo-3xFLAG expression vector to achieve GST and 3xFLAG fusion [39 (link)], respectively. HEK-293T cells were dispensed in each well of a 6-well plate (2 × 10⁶ cells), and 24 h later transfected (JetPRIME; Polyplus) with 500 ng of each plasmid DNA per well. Two days post-transfection, cells were collected in PBS and then incubated on ice in lysis buffer (20 mM MOPS-KOH pH 7.4, 120 mM of KCl, 0.5% Igepal, 2 mM β-Mercaptoethanol, supplemented with Complete Protease Inhibitor Cocktail (Roche)) for 20 min. Cell lysates were clarified by centrifugation at 14,000× g for 30 min. For pull-down analysis, protein extracts were incubated for 2 h at 4 °C on a spinning wheel with 30 μL of glutathione-sepharose beads (Amersham Biosciences) to purify GST-tagged proteins. Beads were then washed 3 times for 5 min with ice-cold lysis buffer and on a spinning wheel and, proteins were recovered by boiling in denaturing loading buffer (Invitrogen).

Fablet A., Kundlacz C., Dupré J., Hirchaud E., Postic L., Sailleau C., Bréard E., Zientara S., Vitour D, & Caignard G. (2022). Comparative Virus-Host Protein Interactions of the Bluetongue Virus NS4 Virulence Factor. Viruses, 14(2), 182.

+ Open protocol

+ Expand

Overexpression of LDHA in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmid pDEST27-LDHA was constructed by subcloning of LDHA cDNA (purchased from Korea Human Gene Bank, Daejeon, Korea) into pDEST27 (Invitrogen) vectors. Two sets of subcloned for LDHA were conducted. For reconstruction of the LDHA, the SNU620/5FU-shLDHA cells were transfected with pDEST27-LDHA and empty pDEST27 plasmid. Briefly, the cells were cultured up to 70% confluency. Then, the cells were treated with a mixture including 3 µg of DNA and Lipofectamine 2000 (Invitrogen) for 48 h. After incubation, the cells were selected with 200 μg/mL G418 for 1 week. Then, to confirm the efficacy of transfection, we performed the Western blot assay.

Han J.H., Kim M., Kim H.J., Jang S.B., Bae S.J., Lee I.K., Ryu D, & Ha K.T. (2021). Targeting Lactate Dehydrogenase A with Catechin Resensitizes SNU620/5FU Gastric Cancer Cells to 5-Fluorouracil. International Journal of Molecular Sciences, 22(10), 5406.

+ Open protocol

+ Expand

Purification of GST-Tagged Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length coding sequences of the target proteins were subcloned into the vector pDEST27 (Invitrogen) or pBabe-CMV-SFB, which generated fusion proteins with N-terminal GST tag or C-terminal S tag-FLAG tag-SBP tag. The vectors were transfected into 293T cells with polyethyleneimine (Sigma-Aldrich, 408727). Cells were lysed after 40 h of transfection. Cells were incubated with NETN-G buffer with 1: 100 cocktail and 10 mM NaF for 30 min at 4 °C. The homogenates were centrifuged at 15,000 rpm for 15 min at 4 °C. Supernatants were incubated with precleared Glutathione Sepharose 4B (GE Healthcare, 17-0756-01) at 4 °C for an hour. After incubation, beads were washed for three times with 0.5 mL NETN-G buffer each time. Samples were then prepared to run western blot analysis.

Li M., Chen Y., Ou J., Huang J, & Zhang X. (2022). PDCL2 is essential for spermiogenesis and male fertility in mice. Cell Death Discovery, 8, 419.

+ Open protocol

+ Expand

Genetic Manipulation and Tagging of TOE1

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length TOE1 (from the human ORFeome v5.1 library) (34 (link)) and TOE1 mutants including DEDD domain deletion (TOE1-ΔDEDD) and catalytically inactive TOE1 (D64A/E66A) were cloned into pLenti-FLAG-HA lentiviral vectors for N-terminal FLAG and HA tagging. For GST-tagging TOE1, pDEST-27 (Invitrogen) vector was used. cDNAs for DKC1, TCAB1, TERT and GFP were cloned into pLenti-FLAG-HA vectors for N-terminal FLAG and HA tagging as well. Full-length and mutant TOE1 were also cloned into the pET vector for tagging with the His tag, expressed in bacteria and purified with Ni sepharose 6 Fast Flow beads (GE healthcare, 17-5318-01).
HeLa and 293T cells were cultured in DMEM media supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. Immunostaining experiments were performed in HeLa cells while other transfection related experiments were done in 293T cells due to its high transfection efficiency. siRNA oligos were ordered from RiboBio and transfected into cells using Lipofectamine® RNAiMAX (Thermo Fisher Scientific). siTOE1-A: 5′-ATAGCATCAAGCCTGAAGA-3′; siTOE1-B: 5′-TACCCTGGAGTTCTGCAAC-3′; siTOE1-C: 5′-GCTCAAGTGTTCAATCTCA-3′; siPARN: 5′- GGAAGAAGAAAGACAGTTATT-3′. The RNAi negative control (siNC) was also purchased from RiboBio.

Deng T., Huang Y., Weng K., Lin S., Li Y., Shi G., Chen Y., Huang J., Liu D., Ma W, & Songyang Z. (2018). TOE1 acts as a 3′ exonuclease for telomerase RNA and regulates telomere maintenance. Nucleic Acids Research, 47(1), 391-405.

+ Open protocol

+ Expand

Cloning of EV-A71 Viral Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

2B, 2C, 2BC, 3A, and 3AB genes of EV-A71 were chemically synthesized from GenScript and cloned into the BamHI and EcoRI sites of pEGFP-N1 vector (Clontech, Mountain View, CA, USA) to generate GFP fusion proteins. The STX17 gene was cloned into pGBKT7 (Clontech) and pCherry (Addgene, Cambridge, MA, USA).) vectors while the 2BC gene of EV-A71 was cloned into the pACT2 (Clontech) and pDEST27 (Thermo, Waltham, MA, USA) vectors. The pmRFP-LC3 and LAMP1-YFP vectors were obtained from Addgene. The tandem tagRFP-eGFP-LC3 vector was purchased from Thermo. The EV-A71 41-eGFP infectious cDNA clone was constructed by cloning the full-length genome of the virus with eGFP into pCR-XL-TOPO (Invitrogen, Carlsbad, CA, USA) as previously described [23 (link)].

Lai J.K., Sam I.C., Verlhac P., Baguet J., Eskelinen E.L., Faure M, & Chan Y.F. (2017). 2BC Non-Structural Protein of Enterovirus A71 Interacts with SNARE Proteins to Trigger Autolysosome Formation. Viruses, 9(7), 169.

+ Open protocol

+ Expand

Pathway Activation Assay for BTV8

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T and HeLa cells were transfected using Polyplus transfection (JetPRIME), according to the manufacturer’s instructions. ORFs-encoding sequences from BTV8 WT strain were cloned into dedicated destination vectors as described in [24 (link)]. GST-tag and 3xFlag-tag fusions were achieved by Gateway cloning using pDEST27 (Thermo Fisher Scientific) and pCI-neo-3xFlag vector, respectively. An expression vector pNRIG-I carrying genes for the constitutively active N-terminal CARDs of human RIG-I (NRIG-I) has been used to stimulate the luciferase reporter gene downstream of an IFN-β specific promoter sequence as previously described [25 (link)]. pcDNA3.1-Flag-TRAF3, pDEST27-MAVS, pcDNA3.0-MAVS-c-Myc and all MAVS mutant constructs were kindly obtained from Eliane F. Meurs (Institut Pasteur, Paris). Moreover, finally, pSPICA-N1 human TRAF3, MAVS, TBK1, IKKε and IRF3, as well as pSPICA-N1-RRS, were generously provided by Yves Jacob and Caroline Demeret (Institut Pasteur, Paris).

Pourcelot M., Amaral Moraes R., Fablet A., Bréard E., Sailleau C., Viarouge C., Postic L., Zientara S., Caignard G, & Vitour D. (2021). The VP3 Protein of Bluetongue Virus Associates with the MAVS Complex and Interferes with the RIG-I-Signaling Pathway. Viruses, 13(2), 230.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!