Pcdna3 flag

Manufactured by Addgene

Sourced in United States

PCDNA3-Flag is a plasmid vector commonly used for the expression of recombinant proteins in mammalian cell lines. It contains a cytomegalovirus (CMV) promoter for high-level expression and a FLAG tag sequence for the detection and purification of the expressed protein.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (6 mentions) Turbofect, by Thermo Fisher Scientific (2 mentions) Pcdna3.1 vector, by Thermo Fisher Scientific (2 mentions) Pcdna3 pkcε flag, by Addgene (2 mentions) Pcdna3 flag mettl3, by Addgene (2 mentions) Small interfering rna oligonucleotides, by Eurofins (1 mentions) Gfp c3, by Takara Bio (1 mentions) Interferin, by Polyplus Transfection (1 mentions) M2 affinity agarose gel, by Merck Group (1 mentions) Pegfp c1, by Addgene (1 mentions) Pcmv myc vector, by Addgene (1 mentions) Nucleobond xtra midi plasmid purification kit, by Macherey-Nagel (1 mentions) Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions) Pcdna3.1 v5 his, by Thermo Fisher Scientific (1 mentions) Pcdna3 myc, by Thermo Fisher Scientific (1 mentions)

9 protocols using pcdna3 flag

siRNA and Plasmid Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small Interfering RNA oligonucleotides were purchased from Eurofins Genomics (Ebersberg, Germany) and used in a final concentration of 27 nM. siRNA transfections in all cell lines were performed using Interferin (Polyplus, Illkirch, France) according to manufacturer’s instructions. Oligonucleotide sequences used for siRNA knockdown are as follows: Control- AACAGUCGCGUUUGCGACU; HIF-1β_#1- GGUCAGCAGUCUUCCAUGA; HIF-1β_#2- GAAAGAAACAUGUGAGUAA; HIF-1α - GCAUAUAUCUAGAAGGUAU; HIF-2α_#1- CAGCAUCUUUGAUAGCAGUTT; HIF-2α _#2- GGCAGAACUUGAAGGGUUA; AHR_#1- UACUUCCACCUCAGUUGGCTT; AHR_#2- GGACAAACUUUCAGUUCUU.
To perform DNA plasmid overexpression in all cell lines, TurboFect (ThermoFisher, Paisley, UK) or GeneJuice (Novagen/ThermoFisher, Paisley, UK) were used according to manufacturer’s instructions. The following expression plasmids were used in this study: GFP-C3 (Clontech/Takara, Montain View, CA, USA); Flag-pcDNA3.1 (a gift from Stephen Smale, Addgene plasmid #20011, Watertown, MD, USA); pEBB-HIF-1β−GFP (kind gift from Colin Duckett, Ann Habour, MI, USA); pCMV5-FLAG TRAF6 (MRC-PPU reagents, Dundee, UK).

D’Ignazio L., Shakir D., Batie M., Muller H.A, & Rocha S. (2020). HIF-1β Positively Regulates NF-κB Activity via Direct Control of TRAF6. International Journal of Molecular Sciences, 21(8), 3000.

+ Open protocol

+ Expand

Investigating MCL1 Nuclear Translocation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assess relevant amino acid residues in regulating the nuclear translocation activity of MCL1, we used PCR-based cloning to generate each of those deletions and cloning into pcDNA 3.1 vector. Flag-fused MCL1 was cloned into Flag-pcDNA 3.1 (Addgene #52535). The resulting plasmids were sequenced to ensure that they encoded the appropriate constructs. Transient plasmid transfection into the indicated cell lines was performed using Lipofectamine 2000 (Life Technologies, Carlsbad, CA) according to the instructions of the manufacturer. Briefly, 2 × 10⁵ cells/well in six-well plates or 1 × 105 cells/well in six-well plates on poly-l-lysine-coated glass coverslips were transiently transfected with 0.5 μg of WT MCL1, various MCL1-expressing constructs, or empty pcDNA3.1 vector (Invitrogen, Carlsbad, CA). The medium was changed after 24 h, and then cells were incubated for 48 h prior to verifying transgene expression by Western blot analysis. Flag-tagged MCL1 proteins were purified by using M2 affinity agarose gel (Sigma, St Louis, MO) according to the protocols from the manufacturer.

Fu D., Pfannenstiel L., Demelash A., Phoon Y.P., Mayell C., Cabrera C., Liu C., Zhao J., Dermawan J., Patil D., DeVecchio J., Kalady M., Souers A.J., Phillips D.C., Li X, & Gastman B. (2022). MCL1 nuclear translocation induces chemoresistance in colorectal carcinoma. Cell Death & Disease, 13(1), 63.

+ Open protocol

+ Expand

Plasmid Construction for NSUN2, NSUN5, and ALYREF

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human NSUN2 and NSUN5 genes were amplified by PCR using human HeLa cDNA and subcloned into pcDNA3-Flag, pEGFP-C1 or pCMV-myc vector (Addgene). The following wild-type plasmids were constructed: pcDNA3-Flag-NSUN2-WT, pEGFP-C1-NSUN2 and pCMV-myc-NSUN2. Flag-tagged human NSUN1 and NSUN6 plasmids were purchased from Vigene Biosciences, China. Myc-Flag-tagged (pCMV6-Entry-ALYREF-Myc-DDK) and GFP-tagged (pCMV6-AC-ALYREF-GFP) human ALYREF plasmids were purchased from Origene Technologies, USA.
The mutant and siRNA insensitive plasmids were generated by introducing point mutations into wild-type plasmids using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies).
To generate the mRNA export minigene construct, FBXW9 mRNA Exon 1 containing one m⁵C modification site (cytosine 215 from start codon AUG) was amplified from human cDNA and inserted into the pEGFP-N1 vector (GenBank: U55762) named pEGFP-FBXW9-WT. The cytosine (C, methylated site) was mutated to adenine (A) using pEGFP-FBXW9-WT as template to generate pEGFP-FBXW9-MUT. All the primers used for cloning are listed in Supplementary information, Table S5.
All plasmids were validated by DNA sequencing, and prepared with the NucleoBond Xtra Midi Plasmid Purification Kit (Machery Nagel).

Yang X., Yang Y., Sun B.F., Chen Y.S., Xu J.W., Lai W.Y., Li A., Wang X., Bhattarai D.P., Xiao W., Sun H.Y., Zhu Q., Ma H.L., Adhikari S., Sun M., Hao Y.J., Zhang B., Huang C.M., Huang N., Jiang G.B., Zhao Y.L., Wang H.L., Sun Y.P, & Yang Y.G. (2017). 5-methylcytosine promotes mRNA export — NSUN2 as the methyltransferase and ALYREF as an m5C reader. Cell Research, 27(5), 606-625.

+ Open protocol

+ Expand

Flag-tagged Plasmid Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

pCDNA3-Flag or pCDNA3-PKCε-Flag (Addgene, Cambridge, MA) plasmids were transfected using Lipofectamine 2000, as recommended by the manufacturer (Thermo Fisher Scientific, Walthan, MA).

Casado-Medrano V., Barrio-Real L., Wang A., Cooke M., Lopez-Haber C, & Kazanietz M.G. (2019). DISTINCTIVE REQUIREMENT OF PKCε IN THE CONTROL OF Rho GTPases IN EPITHELIAL AND MESENCHYMALLY-TRANSFORMED LUNG CANCER CELLS. Oncogene, 38(27), 5396-5412.

+ Open protocol

+ Expand

Flag-tagged Plasmid Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

pCDNA3-Flag or pCDNA3-PKCε-Flag (Addgene, Cambridge, MA) plasmids were transfected using Lipofectamine 2000, as recommended by the manufacturer (Thermo Fisher Scientific, Walthan, MA).

+ Open protocol

+ Expand

Cloning of Functional Protein Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

To construct the V5-His-tagged expression vector of ERRα, the Flag-tagged expression vector of p53, and the EGFP-luciferase-tagged expression vector of mutant p53^P72R, the DNA sequences corresponding to ERRα LBD (aa 193–423), p53 CTD (aa 300–393), and p53^P72R were amplified by PCR. The PrimeSTAR® GXL DNA Polymerase high fidelity enzyme (Takara Bio, Mountain View, CA, USA) was used for PCR. We designed specific primers for V5-His-ERRα (aa 193–423) as follows: F: 5′atggatccatgccagtgaatgcactggtgtc3′; R: 5′cgtctagagtccatcatggcctcgagcatc3′; Flag-p53 (aa 300–393) F: 5′ atggatcccccccagggagcactaagcga3′; R: 5′cctctagatgcatgctcgagtcag3′; and EGFP-luciferase-p53^72R F: 5′ atctcgaggatggaggagccgcagtcag3′; R: 5′ cgaccggtttagtctgagtcaggcccttctgtc3′. The V5-His-ERRα (aa 193–423), Flag-p53 (aa 300–393), and EGFP-luciferase-p53^72R PCR products were digested with BamHI-HF/Xba I and Xho I/Age I following instructions provided by the manufacturer (New England Biolabs, Ipswich MA, USA). The constructs were then inserted into the corresponding sites of pcDNA3.1/V5-His (Invitrogen by Thermo-Fisher Scientific), and pcDNA3/Flag and pLentipuro3/TO/V5/GW/EGFP/luciferase (Addgene Inc., Cambridge, MA, USA) to generate the encoding expression plasmids. Sanger DNA sequencing and the Blast program were used to confirm that the DNA was inserted into the corresponding sites.

De Vitto H., Ryu J., Calderon-Aparicio A., Monts J., Dey R., Chakraborty A., Lee M.H., Bode A.M, & Dong Z. (2020). Estrogen-related receptor alpha directly binds to p53 and cooperatively controls colon cancer growth through the regulation of mitochondrial biogenesis and function. Cancer & Metabolism, 8, 28.

+ Open protocol

+ Expand

Generating Catalytically Dead METTL3

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids pCDNA3‐FLAG and pCDNA3‐FLAG‐METTL3 were purchased from Addgene. The catalytically dead mutant of METTL3 was conducted from pCDNA3‐FLAG‐METTL3 using QuikChange II Site‐Directed Mutagenesis Kit. The residues 395−398, DPPW, were mutated to APPA.

Zhang H., Wu D., Wang Y., Guo K., Spencer C.B., Ortoga L., Qu M., Shi Y., Shao Y., Wang Z., Cata J.P, & Miao C. (2023). METTL3‐mediated N6‐methyladenosine exacerbates ferroptosis via m6A‐IGF2BP2‐dependent mitochondrial metabolic reprogramming in sepsis‐induced acute lung injury. Clinical and Translational Medicine, 13(9), e1389.

+ Open protocol

+ Expand

Cloning of GAS5, IRF1, HDAC2, and CtBP1 into Expression Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The GAS5 mRNA sequence was amplified with the CGGGATCCCAGCACTTGAGCAGCTTTCTTCT (forward) and CCGGAATTCTGGATTGCAAAAATTTATT (reverse) primers and cloned into the BamHI and EcoRI sites of pCDNA3.1 vector (Invitrogen, California, USA, #V79020). Full-length coding sequences of IRF1, HDAC2, and CtBP1 were amplified with the following primers: (1) IRF1-F, CGGGATCCATGCCCATCACTCGGATGCGCA, and IRF1-R, CCGGAATTCCTACGGTGCACAGGGAA; (2) HDAC2-F, CGGGATCCATGGCGTACAGTCAAGGAGGC, and HDAC2-R, CCGGAATTCTCAGGGGTTGCTGAGC; and (3) CtBP1-F, CGGGATCCATGGGCAGCTCGCACTTGC, and CtBP1-R, CCGGAATTCCTACAACTGGTCACTGGCGTGGTCT, and were then cloned into the BamHI and EcoRI sites in the pCDNA3-Flag (Addgene, Massachusetts, USA, #20011) and pCDNA3-Myc (Invitrogen, #V80020) vectors. The plasmids of these vectors were purified with a GeneElute^TM Five-Minute Plasmid Miniprep Kit (Sigma-Aldrich, Missouri, USA, #PFM50) following the manufacturer's protocol.

Zhang X., Du K., Lou Z., Ding K., Zhang F., Zhu J, & Chang Z. (2019). The CtBP1-HDAC1/2-IRF1 transcriptional complex represses the expression of the long noncoding RNA GAS5 in human osteosarcoma cells. International Journal of Biological Sciences, 15(7), 1460-1471.

+ Open protocol

+ Expand

Plasmid Construction and Lentiviral Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids pCDNA3-FLAG and pCDNA3-FLAG-METTL3 were purchased from Addgene (Cambridge, MA USA). The catalytically dead mutant of METTL3 was conducted from pCDNA3-FLAG-METTL3 by using QuikChange II Site-Directed Mutagenesis Kit (California, CA USA). The residues 395–398, DPPW, were mutated to APPA. The mutant primers were synthesized as follows: forward 5ʹ-AGTTGTGATGGCTGCCCCACCCGCGGATATTCACATGGAACTG-3ʹ; reverse 5ʹ- CAGTTCCATGTGAATATCCGCGGGTGGGGCAGCCATCACAACT-3ʹ.
Lipofectamine 2000 (Invitrogen, Carlsbad, CA USA) was used for transit transfection according to the instruction. Scramble and METTL3 shRNAs were purchased from Sigma Aldrich (St. Louis, MO USA).
The lentiviruses were packaged in 293T cells through co-transfection with pLP1, pLP2, and VSVG. Supernatants containing lentiviral particles was collected and concentrated by addition of PEG, and cells were transduced and selected with puromycin.

Cai J., Yang F., Zhan H., Situ J., Li W., Mao Y, & Luo Y. (2019). RNA m6A Methyltransferase METTL3 Promotes The Growth Of Prostate Cancer By Regulating Hedgehog Pathway. OncoTargets and therapy, 12, 9143-9152.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!