The predicted regions of DDX11-AS1 and RWDD4 containing miR-499b-5p-binding elements were inserted into pGL3 reporter plasmid. Then, luciferase reporter plasmid and miR-499b-5p mimics were co-transfected into glioma cells. After 48 h, the luciferase activity was measured using Promega Luciferase Reporter detection kits (Promega).
Luciferase reporter detection kits
Manufactured by Promega
Sourced in China
Promega Luciferase Reporter detection kits are laboratory equipment designed to measure and quantify luciferase reporter gene activity. The kits provide reagents and protocols to detect and analyze luciferase-based reporter gene expression in various experimental systems.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using luciferase reporter detection kits
1
Validating miR-499b-5p Binding Sites
2
Luciferase Assay for miR-1225 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The predicted miR-1225 binding site in the 3′-UTR of FNDC3B mRNA sequence was constructed into pGL3 luciferase reporter vectors (wild-type: WT), and corresponding mutant binding site sequence was also constructed (mutant: MUT). The reporters were named as follows: FNDC3B WT and FNDC3B MUT. Correspondingly, the wild-type or mutant-type LINC00355 sequence was, respectively, constructed into pGL3 empty vectors to form LINC00355 WT or LINC00355 MUT luciferase reporters. The vectors were constructed by NaYe Biological Company (Hangzhou, Zhejiang, China). After the cells were attached on the plates, they were cotransfected with designated luciferase reporter vectors and miR-1225 mimics or controls. After 48 h, the luciferase activities of glioma cells were determined by the use of Promega luciferase reporter detection kits (JunShangBio, Chengdu, Sichuan, China).
3
Luciferase Reporter Assay for miR-383 and ADAM12
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence region containing predicted binding site 2 (S2 WT) of LINC01614 promoter or the corresponding mutant-type (MUT) sequence (S2 MUT) was, respectively, cloned into pGL3 reporter plasmid. LINC01614 sequence was then constructed into pGL3 reporter plasmid (LINC01614 wild-type), and LINC01614 sequence containing the predicted mutant-type binding site between LINC01614 and miR-383 was also cloned into pGL3 reporter plasmid (LINC01614 mutant-type). In addition, the luciferase reporter plasmids of wild-type ADAM12 (ADAM12 wt1, ADAM12 wt2) or matched mutant-type ADAM12 (ADAM12 mut1, ADAM12 mut2) were also constructed. The vector construction was performed by Geno Biological company (Changsha, Hunan, China). Glioma cells were co-transfected with corresponding luciferase reporters plus Renilla luciferase plasmid (pRL-TK) and miR-383 mimics. Then, the cells were harvested after 48 hrs for luciferase detection by using Promega Luciferase Reporter detection kits (Songhong, Qingdao, Shandong, China).
4
Validation of ZEB2-3'UTR Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The normal sequence of ZEB2-3′ UTR containing a miR-125-5P binding site and its mutated 3′ UTR sequence were synthesized by PCR amplification and integrated into the pYr-MirTarget basic vector. HEK293T cells were seeded in 24-well plates with a density of 5 × 104 cells/well. After 12 h, cells were transfected with 50 nM miR-125-5p mimic or negative controls by using Lipofectamine™ 2000, followed by cotransfection with 2 μg of the WT or 3′ UTR-mutant of ZEB2, respectively. Luciferase activities were performed under the instruction of Luciferase Reporter Detection Kits (C0037, Promega, USA) at 48 h posttransfection. Each sample was duplicated at least 3 times. The sequences were as follows: ZEB2-3′UTRMUT F:CATTTAATTTAACGACTAATAACATTTTATTTATGTGG, ZEB2-3′UTRMUT R:AAAATGTTATTAGTCGTTAAATTAAATGAATGCAAAAA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!