Log In Sign up
The largest database of trusted experimental protocols

Taqman gene specific primers

Manufactured by Thermo Fisher Scientific
Visit Supplier

TaqMan gene-specific primers are DNA sequences designed to target and amplify specific regions of a gene during a polymerase chain reaction (PCR) process. They are used to quantify the expression levels of specific genes in a variety of sample types. TaqMan primers are a core component of the TaqMan gene expression analysis workflow.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (2 mentions) 7300 real time pcr system, by Thermo Fisher Scientific (1 mentions) Taqman reverse transcription reagents kit, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Sensifast kit, by Meridian Bioscience (1 mentions) Automated robot platform, by Gilson (1 mentions) Pipetmax qpcr assistant, by Gilson (1 mentions) Allprep rna mini kit, by Qiagen (1 mentions) Gene expression assay, by Thermo Fisher Scientific (1 mentions) Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions) Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Allprep dna rna mini kit, by Qiagen (1 mentions)

Close spelling variants of this product

Universal TaqMan master mix and primer/probe sets specific for the genes (2 citations) Mouse specific Taqman gene primers (2 citations) TaqMan Gene Expression Assays specific PCR primers sets (3 citations) TaqMan PCR Master Mix with gene-specific primers (3 citations) Rhesus-specific TaqMan gene expression primers (4 citations) Specific TaqMan primers (14 citations) Gene-specific primers (57 citations) Specific primers (81 citations) TaqMan primers (539 citations)

6 protocols using taqman gene specific primers

1

Quantitative gene expression analysis in SMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total cellular RNA was isolated from SMCs cultured in 0.2% fetal bovine serum (FBS) Dulbecco’s Modified Eagle Medium (DMEM) or from common carotid arteries using standard procedures, and retro-transcribed to cDNA. Real time qPCR was performed with the following gene specific primers (Nox4: Forward primer-5′TGGCCAACGAAGGGGTTAAA3′, Reverse primer-5′ACACAATCCTAGGCCCAACA3′; EPHX2: Forward primer-5′CAGGAGGACACAGACACCATA3′, Reverse primer-5′TCTCAGGTAGATTGGCTCCAC3′) using SYBR-Green-based detection, or TAQMAN gene specific primers (Applied Biosystems), according to the following cycling conditions: denaturation, annealing, and extension at 95 °C, 57 °C and 72 °C for 10 s, 30 s, and 10 s, respectively, for 40 cycles. β-actin was used as internal control.
Tong X., Khandelwal A.R., Wu X., Xu Z., Yu W., Chen C., Zhao W., Yang J., Qin Z., Weisbrod R.M., Seta F., Ago T., Lee K.S., Hammock B.D., Sadoshima J., Cohen R.A, & Zeng C. (2016). Pro-atherogenic Role of Smooth Muscle Nox4-based NADPH oxidase. Journal of molecular and cellular cardiology, 92, 30-40.
+ Open protocol
+ Expand
2

Quantification of Nox4 and EPHX2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total cellular RNA was isolated from EC cultured in 0.2% FBS EBM-2 or from common carotid arteries and aorta using standard procedures, and retro-transcribed to cDNA. Quantitative PCR was performed with the following gene specific primers: Nox4, Forward primer-5′TGGCCAACGAAGGGGTTAAA3′, Reverse primer-5′ACACAATCCTAGGCCCAACA3′; EPHX2: Forward primer-5′CAGGAGGACACAGACACCATA3′, Reverse primer-5′TCTCAGGTAGATTGGCTCCAC3′ using SYBR-Green-based detection, or Taqman gene specific primers (Applied Biosystems), using the following cycling conditions: denaturation, annealing, and extension at 95 °C, 57 °C and 72 °C for 10 s, 30 s, and 10 s, respectively, for 40 cycles. β-actin or 18S were used as endogenous control.
Hu P., Wu X., Khandelwal A.R., Yu W., Xu Z., Chen L., Yang J., Weisbrod R.M., Lee K.S., Seta F., Hammock B.D., Cohen R.A., Zeng C, & Tong X. (2017). Endothelial Nox4-based NADPH oxidase regulates atherosclerosis via soluble epoxide hydrolase. Biochimica et biophysica acta, 1863(6), 1382-1391.
+ Open protocol
+ Expand
3

Bim mRNA Half-Life Determination by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The half-life of Bim mRNA was determined by qRT-PCR analysis following actinomycin D treatment. Total cell RNA was isolated using TRIzol according to the manufacturer's instructions (Invitrogen). RNA was then reverse transcribed using the TaqMan Reverse Transcription Reagents Kit (Applied Biosystems) and amplified on a 7300 Real-Time PCR system (Applied Biosystems) with TaqMan gene-specific primers (Applied Biosystems). The relative amount of RNA for each gene was expressed after normalization to β-actin. All standards and samples were tested in triplicate wells, and data were analyzed using SDS software version 2.3.
Gao Z., Shang Q., Liu Z., Deng C, & Guo C. (2015). Mitochondrial ATF2 translocation contributes to apoptosis induction and BRAF inhibitor resistance in melanoma through the interaction of Bim with VDAC1. Oncotarget, 6(34), 36338-36353.
+ Open protocol
+ Expand
4

Comparative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To compare gene expression changes of MSMB, NCOA4, KLK2 and KLK3 from different transfection and isogenic clones, cells were harvested at 60–90% confluence for total RNA extraction with Qiagen RNeasy Mini kit (Qiagen, Hilden, Germany) and quantified by Nanodrop spectrophotometer (ThermoScientific, ND-8000). 1μg extracted RNA were then reverse transcribed into cDNA with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems #4368814). For real time PCR, TaqMan gene-specific primers were ordered from Life Technologies for MSMB (Hs00159303_m1), NCOA4 (Hs01033772_g1), KLK2 (Hs00428383_m1) and KLK3 (Hs02576345). GAPDH was used as internal control. qPCR reactions were setup according to the TaqMan Gene Expression Assays protocol and performed on a ViiA7 real time PCR system (Applied Biosystems, Life Technologies). Each sample was amplified in duplicate, average gene expression and standard deviation were calculated. Relative gene expression was analyzed with the ΔΔCT method (Applied Biosystems, cms_042380).
Wang X., Hayes J.E., Xu X., Gao X., Mehta D., Lilja H.G, & Klein R.J. (2020). Validation of prostate cancer risk variants rs10993994 and rs7098889 by CRISPR/Cas9 mediated genome editing. Gene, 768, 145265.
+ Open protocol
+ Expand
5

Quantitative Gene Expression Analysis of Cultured Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cultured cells using Allprep RNA Mini Kit (Qiagen, Valencia, CA) and measured by Nanodrop. First strand cDNA synthesis was performed using the SensiFAST kit (Bioline). Pre-designed TaqMan gene specific primers (Life Technologies, Carlsbad, CA) were used (Supplemental Methods). qPCR reactions were set up on an automated robot platform (Gilson, Inc Middleton, WI, USA) and PIPETMAX qPCR assistant. Samples were normalized to normal human lung tissue. All reactions were performed in triplicate from RNA isolated from three independent biological experiments.
SenthilKumar G., Fisher M.M., Skiba J.H., Miller M.C., Brennan S.R., Kaushik S., Bradley S.T., Longhurst C.A., Buehler D., Nickel K.P., Iyer G., Kimple R.J, & Baschnagel A.M. (2020). FGFR inhibition enhances sensitivity to radiation in non-small cell lung cancer.. Molecular cancer therapeutics, 19(6), 1255-1265.
+ Open protocol
+ Expand
6

Quantification of Neuroendocrine Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cells using Allprep DNA/RNA Mini Kit (Qiagen, Valencia, CA). SuperScript VILO cDNA Synthesis Kit (Invitrogen, Carlsbard, CA) was used for the synthesis of cDNA from RNA. The following predesigned TaqMan gene specific primers (Life Technologies) were used: CHGA (Assay ID: Hs00900375_m1), CHGB (Assay ID: Hs01084631_m1), GAPDH (Assay ID: Hs99999905_m1), SCG3 (Assay ID: Hs00203076_m1), and SST (Assay ID: Hs00356144_m1). Quantitative RT-PCR reaction mixture was prepared containing 2 uL cDNA (10 ng), 1x TaqMan Gene Expression Master Mix (Life Technologies), and 1x Gene Expression Assay (Life Technologies). Gene expression levels were quantified using the ViiA 7 Real-Time PCR system (Life Technologies). The following thermocycling condition was used: 50°C for 2 min, 95°C for 10 min, and 40 amplification cycles of 95°C for 15 s/60°C for 1 min. Relative gene expression levels were calculated by the 2 -ΔΔCT method, where delta delta CT value (ΔΔCT) = (CT target -CT housekeeping ) -(CT control -CT housekeeping ). All expression values were normalized to the housekeeping gene GAPDH. If gene expression was not detectable after 40 amplification cycles, the sample was excluded for further statistical analysis. Error bars are the relative quantification minimum (RQ min ) and maximum (RQ max ) which represent the standard error of the mean (SEM) expression levels.
Johnson M.D., Stone B., Thibodeau B.J., Baschnagel A.M., Galoforo S., Fortier L.E., Ketelsen B., Ahmed S., Kelley Z., Hana A., Wilson T.G., Robertson J.M., Jury R.P, & Wilson G.D. (2017). The significance of Trk receptors in pancreatic cancer. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 39(2).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!