Pires2 dsred2

Manufactured by Takara Bio

Sourced in Canada, United States

PIRES2-DsRed2 is a plasmid vector that expresses the DsRed2 fluorescent protein under the control of the PIRES2 promoter. DsRed2 is a variant of the Discosoma sp. red fluorescent protein that exhibits improved brightness and maturation properties compared to the original DsRed protein.

Automatically generated - may contain errors

Lab products found in correlation

Pgex 6p 1, by GE Healthcare (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Pires2 egfp, by Takara Bio (1 mentions) Bz x710, by Keyence (1 mentions) X tremegene 9 dna transfection reagent, by Roche (1 mentions)

Close spelling variants of this product

PIRES2-DsRed2 vector DsRed2

4 protocols using pires2 dsred2

Molecular Characterization of PIDD-DNA-PKcs Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human cervical cancer HeLa cells, human embryonic kidney 293 cells, human colon cancer HCT116 Ku86^flox/− cells (16 (link)), Chinese hamster ovary cells deficient in DNA-PKcs (V3) and V3-complemented cells were maintained in α–minimum essential medium (HyClone) supplemented with 10% fetal bovine serum in a humidified incubator at 37°C with 5% CO₂. Small interfering RNA (siRNA) oligonucleotide duplexes designed against PIDD (siPIDD#1: CAGACUGUUCCUGACCUCAGA, siPIDD#2: GCAGCCCUCAUUCCAGAAA, siPIDD#3: UCCUUGUCCUGCACAGCAA, Invitrogen) were transfected with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Full-length or truncated PIDD were amplified and cloned into pIRES2-DsRed2 (Clontech) or pcDNA3.1⁺/N-HA (Invitrogen) for mammalian expression. DNA-PKcs cDNA fragments were cloned into pGEX-6P1 (GE Healthcare Life Sciences) for Glutathione S-transferase (GST) fusion protein, and PIDD cDNA fragments were cloned into pET28a (Novagen) for His-tagged protein.

Lin Y.F., Shih H.Y., Shang Z.F., Kuo C.T., Guo J., Du C., Lee H, & Chen B.P. (2018). PIDD mediates the association of DNA-PKcs and ATR at stalled replication forks to facilitate the ATR signaling pathway. Nucleic Acids Research, 46(4), 1847-1859.

+ Open protocol

+ Expand

Heterologous Expression of Rare KCNQ1 Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three case-derived KCNQ1 MVs (F127L, P477L, and L619M) that were considered “ultra-rare” (i.e. absent in > 140,000 individuals) but had a “likely benign” composite in silico tool score were selected for further heterologous expression studies to determine if they represent true pathogenic variants or benign, false-positive calls. Wild-type KCNQ1 and KCNE1 cDNA were subcloned into pIRES2-EGFP (Clontech, Mountain View, CA) and pIRES2-dsRed2 (Clontech, Mountain View, CA) respectively to produce pIRES2-KCNQ1-WT-EGFP and pIRES2-KCNE1-WT-dsRed2. The Quickchange XL Site-Directed Mutagenesis Kit was used to engineer the F127L, P477L, and L619M variants into pIRES2-KCNQ1-WT-EGFP. DNA sequencing was used to confirm the integrity of all vectors.

Clemens D.J., Lentino A.R., Kapplinger J.D., Ye D., Zhou W., Tester D.J, & Ackerman M.J. (2017). Utilizing the Genome Aggregation Database, Computational Pathogenicity Prediction Tools, and Patch Clamp Heterologous Expression Studies to Demote Previously Published Type 1 Long QT Syndrome Mutations from Pathogenic to Benign. Heart rhythm, 15(4), 555-561.

+ Open protocol

+ Expand

Construction of rpsLneo-DsRed2 Cassette

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 1

A 2.8-kb DNA fragment of rpsLneo-DsRed2 cassette was constructed by PCR reactions (FIG. 1). Briefly, three PCR reactions were conducted. First PCR reaction was conducted using primer pair of SEQ ID NO: 1 (5′-GGCCTGGTGATGATGGCGGGATCGTTGTAT-3′) and SEQ ID NO: 2 (5′-CCATGGTGCTGCGCTCAGAAGAACTCGTCA-3′) with the template of synthesized fragment of rpsLneo (SEQ ID NO: 3). Second PCR reaction was conducted using primer pair of SEQ ID NO: 4 (5′-ACGAGTTCTTCTGAGCGCAGCACCATGGCC-3′) and SEQ ID NO: 5 (5′-TCGGAGGAGGCCATCCTTAAGAGCTGTAAT-3′) with the template plasmid of pSI Mammalian Expression Vectors (Promega, Cat# E1721). Third PCR reaction was conducted using primer pair of SEQ ID NO: 6 (5′-TACAGCTCTTAAGGATGGCCTCCTCCGAGA-3′) and SEQ ID NO: 7 (5′-GCAGTGAAAAAAATGCTTTATTTGTGAAAT-3′) with the template plasmid of pIRES2-DsRed2 (Clontech, Cat#632420). Another PCR reaction was conducted using a mixture of PCR products from the first and second PCR reactions as a template and SEQ ID NO: 1 and SEQ ID NO: 5 as primers. This PCR product and the PCR product from third PCR reaction were mixed and used for final PCR reaction with primer pair of SEQ NO: 1 and SEQ NO: 7, resulting in rpsLneo-DsRed2 cassette.

US10246685B2. Recombinant MDV1 and the uses thereof (2019-04-02). Ceva Sante Animale [FR]. Inventors: Yukari Ishihara [JP], Motoyuki Esaki [JP], Shuji Saitoh [JP].

+ Open protocol

+ Expand

Immunostaining of LC3 in Transfected COS Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full‐length complementary DNAs for mouse FSP27α or FSP27β were subcloned into the expression plasmid pIRES2‐DsRed2 (Clontech, Mountain View, CA, USA) 7, and the resulting vectors were introduced into COS cells with the use of the X‐tremeGENE 9 DNA Transfection Reagent (Roche Applied Science, Penzberg, Upper Bavaria, Germany). The cells were subsequently fixed with phosphate‐buffered saline (PBS) containing 4% paraformaldehyde at room temperature, washed with PBS and exposed to PBS containing 5% bovine serum albumin. For immunostaining of LC3, the cells were permeabilized with 0.2% Triton X‐100 for 5 min, exposed to PBS containing 5% bovine serum albumin, and then incubated consecutively with rabbit antibodies to LC3 (Medical & Biological Laboratories) and Dylight405‐conjugated goat antibodies to rabbit immunoglobulin G (ThermoScientific, Waltham, MA, USA). The cells were finally examined with a confocal laser‐scanning microscope (BZ‐X710; Keyence).

Nakajima S., Nishimoto Y., Tateya S., Iwahashi Y., Okamatsu‐Ogura Y., Saito M., Ogawa W, & Tamori Y. (2019). Fat‐specific protein 27α inhibits autophagy‐dependent lipid droplet breakdown in white adipocytes. Journal of Diabetes Investigation, 10(6), 1419-1429.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!