Total RNA of each foliar replicate (i.e. a foliar disc of 1 cm in diameter) of Cry10Aa T0 GM cotton plants was isolated using Concert (INVITROGEN, Carlsbad, Califórnia, EUA®) following the manufacturer's instructions. All of the RNA extractions were performed in biological triplicate. Prior to the cDNA synthesis, all of the RNA samples were treated with 1 U of Ambion® DNase I RNase‐free™ (INVITROGEN®). The cDNA was retro transcribed from 1.0 μg of total RNA using 200 U of Moloney Murine Leukaemia Virus Reverse Transcriptase (M‐MLV RT) (INVITROGEN®) and oligo‐dTNVd30, following the instructions of the M‐MLV RT manufacturer. The primers used in these experiments are presented in Table S6 The fluorescence raw data from all qPCR amplification runs were imported into the Real‐time PCR Miner software (Zhao and Fernald, 2005 ) to determine the Ct value and qPCR efficiency. Gene expression analyses were completed using qBASE Plus software (Hellemans et al., 2007 ). Statistical analysis was performed using the REST software (QIAGEN®, Germany).
Ambion dnase 1 rnase free
Manufactured by Thermo Fisher Scientific
Sourced in United States
Ambion™ DNase I (RNase Free) is a laboratory reagent used to degrade DNA in RNA samples. It is an endonuclease that catalyzes the hydrolytic cleavage of phosphodiester linkages in DNA, removing contaminating DNA from RNA preparations.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Rest software, by Qiagen (1 mentions)
7500 rt pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Dna free dna removal kit, by Thermo Fisher Scientific (1 mentions)
Trizol rna isolation reagent, by Thermo Fisher Scientific (1 mentions)
Cfx384 touch real time pcr detection system, by Bio-Rad (1 mentions)
5 protocols using ambion dnase 1 rnase free
1
Cry10Aa GM Cotton Transcriptome Analysis
2
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from whole brains of mice with or without transcardiac perfusion with 5 mL of sterile saline (indicated throughout Results section and Figure Legends), using TRIzol Reagent (Invitrogen, cat# 15596026) according to manufacturer’s instruction. Purity and integrity of RNA were determined by the 260/280 nm absorbance ratio and by electrophoresis in agarose gels. Only preparations with ratios >1.8 and no sign of RNA degradation were used. One µg of RNA was treated with Ambion DNase I RNase-free (Invitrogen, cat# AM2222) before cDNA synthesis (High Capacity cDNA reverse transcription kit, Invitrogen, cat# 4368814) according to manufacturer’s instructions. Expression of genes of interest was analyzed by qPCR on an Applied Biosystems 7500 RT-PCR system using the Power SYBR kit (Applied Biosystems, cat# A25742). Primer pairs were: Act: Fw TGTGACGTTGACATCCGTAAA and Rv GTACTTGCGCTCAGGAGGAG, rRNA 16 s: Fwd TCGTCAGCTCGTGTYGTGA and Rv CGTAAGGGCCATGATG. Cycle threshold (Ct) values were used to calculate fold changes in gene expression using the 2–ΔCt method. In all cases, reactions were performed in 15 µl volume.
3
Fecal Sample DNA Purification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animal fecal samples were weighed in 50 mL sterile conical tubes. Sterile phosphate-buffered saline (PBS) was added at 1 mL/g and vortexed for 5 min. Sterile PBS was also used as a negative control. The samples were centrifuged at 15,000g for 10 min, and the supernatant was filtered through 0.45 μm and 0.22 μm filters. Serum samples were filtered directly through 0.45 μm and 0.22 μm filters. In order to remove any free DNA, 1 mL aliquot of each sample was incubated with Ambion™ DNase I (RNase Free) (Thermo Fisher Scientific, United States) at 37°C for 1 h in a water bath at a final concentration of 0.1 U (unit) per μL. The DNase was deactivated by treating with 50 mM EDTA at 75°C in a heat block for 10 min.
4
RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extracted total RNA was treated with Ambion™ DNase I (RNase free) (ThermoFisher Scientific, Vilnius, Lithuania) in the presence of the 10 x DNase Buffer and incubated at 37°C for 30 min. DNase I was inactivated by 2 min incubation with DNase Inactivation Reagent from the DNA-free™ DNA Removal Kit (ThermoFisher Scientific, Vilnius, Lithuania). The mixture was centrifuged at 10,000 x g for 1.5 min and the supernatant containing DNA-free RNA was transferred to a new tube.
The total RNA was reverse-transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Vilnius, Lithuania) according to the manufacturer’s instructions. The reverse-transcription mixture was incubated for 10 min at 25°C, 120 min at 37°C and 5 min at 85°C. Complementary DNA (cDNA) was stored at −20°C until further use.
The total RNA was reverse-transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Vilnius, Lithuania) according to the manufacturer’s instructions. The reverse-transcription mixture was incubated for 10 min at 25°C, 120 min at 37°C and 5 min at 85°C. Complementary DNA (cDNA) was stored at −20°C until further use.
5
C. elegans Total RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from C. elegans N2 strain were extracted using a Trizol® RNA isolation reagent (Thermo Fisher Scientific, Paisley, UK) following the manufacturer’s instructions. Absorbance at 260/280 nm in a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) was used to determine the concentration and purity of RNA. DNA-free RNA was obtained for all samples by treating 1000 ng of RNA with DNAse (Ambion™ DNase I, RNase-free; Thermo Fisher Scientific, Inc., Waltham, MA, USA) following the manufacturer’s instructions and then reverse-transcribed into cDNA following the previously described protocol [30 (link)].
Gene expression analyses were performed by quantitative real-time PCR (qPCR) using the CFX384 Touch™ Real-Time PCR Detection System (BioRad, Hercules, CA, USA). For these assays, TaqMan Universal PCR master mix and specific probes (Table S1 ) from Applied Biosystems Technologies (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and Integrated DNA Technologies, Inc. (Coralville, IA, USA) were used. The expression level of pmp-3 gene was used as housekeeping control gene [36 (link)]. Gene expression differences between treated and untreated worms were quantified using the relative quantification 2−∆∆Ct method [37 (link)].
Gene expression analyses were performed by quantitative real-time PCR (qPCR) using the CFX384 Touch™ Real-Time PCR Detection System (BioRad, Hercules, CA, USA). For these assays, TaqMan Universal PCR master mix and specific probes (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!