According to the method provided in the literature to carry out the experimental operation (22 (link)), U251 cells were cross-linked with formaldehyde, lysed in SDS buffer, and sheared mechanically by sonication to fragment the DNA. Protein–DNA complexes were precipitated with 2 μg control rabbit IgG (CST, Cat. No. 2729), anti-Histone H3 (D2B12) XP® Rabbit mAb (CST, Cat. No. 4620), and anti-ZNF655 (Novus, Cat. No. NBP1-78732, Littleton, CO, USA) antibodies, respectively. The complex was eluted from the antibodies, and the eluted DNA fragment was assessed by qPCR. Real-time PCR was performed using primers specific for the AURKA promoter (chr20:56367390-56394196) and SYBR premix (Vazyme). The AURKA primers are listed as follows: forward primer 5′-AGAACGTTCACTCGCCAGGTA-3′, reverse primer 5′-GCATCTGTGTTCTAGCCTTTCCA-3′.
Sybr premix
Manufactured by Vazyme
Sourced in China
SYBR Premix is a ready-to-use solution for real-time PCR detection, containing SYBR Green I dye and optimized buffer components.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Trizol, by Takara Bio (4 mentions)
Hiscript q rt supermix, by Vazyme (4 mentions)
Reverse transcription kit, by Takara Bio (3 mentions)
Trizol reagent, by Merck Group (3 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (2 mentions)
Normal mouse igg control, by Merck Group (2 mentions)
Anti e2f1, by Proteintech (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase kit, by Takara Bio (2 mentions)
Tripure reagent kit, by Takara Bio (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Primescript rt kit, by Vazyme (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Vazyme (1 mentions)
Rt reagent kit, by Vazyme (1 mentions)
Quantstudio 5, by Thermo Fisher Scientific (1 mentions)
Molpure trieasy plus total rna kit, by Yeasen (1 mentions)
Quantstudio 6, by Thermo Fisher Scientific (1 mentions)
26 protocols using sybr premix
1
ChIP-qPCR Analysis of AURKA Promoter
2
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 50 mg tumor samples using TRIzol® according to the manufacturer's protocol. Reverse transcription was performed using PrimeScript RT reagent kit according to the manufacturers' instructions. RT-PCR was performed using SYBR Premix (Vazyme Biotech Co., Ltd.) on a StepOne RealTime PCR system (Applied Biosystems). The qPCR conditions used were as follows: Initial denaturation at 95°C for 3 min, followed by 40 cycles of 95°C for 5 sec and 58°C for 30 sec. The sequences of the primers used in the present study are presented in Table I . Each sample was assessed in triplicate. The relative expressions levels were normalized to the endogenous control GAPDH and were expressed as 2−ΔΔCq (27 (link)).
3
Quantitative Real-Time PCR Analysis of Pig Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were isolated using Trizol (Takara, Otsu, Japan). The final concentrations were measured by NanoDrop 2000 (Thermo, Waltham, MA, USA). The cDNA was synthesized using a reverse transcription kit (Takara, Otsu, Japan). We used quantitative real-time PCR (RT-qPCR) for mRNA analysis. Every reaction was performed in triplicate with SYBR Premix (Vazyme, Nanjing, China) on a StepOne Real-Time PCR Machine (ABI, Carlsbad, CA, USA) [25 ]. The relative mRNA level was normalized to that of Gapdh and calculated using the 2-∆∆Ct algorithm. The primer sequences we used for the RT-qPCR are listed in Table 1 .
Primer sequences used in this study (Sus scrofa)
| Gene name | Forward | Reverse |
|---|---|---|
| Cyclin B | 5’-AATCCCTTCTTGTGGTTA-3’ | 5’-CTTAGATGTGGCATACTTG-3’ |
| Cyclin D | 5’-TACACCGACAACTCCATCCG-3’ | 5’-GAGGGCGGGTTGGAAATGAA-3’ |
| Cyclin E | 5’-AGAAGGAAAGGGATGCGAAGG-3’ | 5’-CCAAGGCTGATTGCCACACT-3’ |
| Star | 5’-CGTTTAAGCTGTGTGCTGGG-3’ | 5’-TCCATGACCCTGAGGTTGGA-3’ |
| Cyp11a1 | 5’-GGGCAACCCATTTCCTACCA-3’ | 5’-CGAGCACTGGTGGTACAGAC-3’ |
| Cyp19a1 | 5’-TCCGCAATGACTTGGGCTAC-3’ | 5’-GCCTTTTCGTCCAGTGGGAT-3’ |
| Mfn2 | 5’-AGCGGCTGCGGTTTATC-3’ | 5’-TCTATATGGCGATGCAGTTCA-3’ |
| NR5A1 | 5’-CTGCCTCAAGTTCCTCATTCTC-3’ | 5’-GGTAGTGGCACAGGGTGTAATC-3’ |
| Gapdh | 5’-AGGTCGGAGTGAACGGATTTG-3’ | 5’-CCATGTAGTGGAGGTCAATGAAG-3’ |
4
Retinal RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Invitrogen, Carlsbad, CA, United States) was applied to extract total RNA from the retinas of EAU mice on the 14th day after injection. The extracted RNA was reverse transcribed into cDNA using the PrimeScript RT kit (Vazyme, China). SYBR premix (Vazyme, China) was used for final quantitative PCR detection. All the primers are listed in Table 1
5
Regulation of BIRC5 by E2F1 in HCT-116 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCT-116 cells overexpressing RFWD3 were cross-linked with formaldehyde, lysed in SDS buffer, and mechanically sheared by sonication to fragment DNA. Protein–DNA complexes were precipitated using 2 μg control normal mouse IgG (Sigma, Cat. No. I5381), 2 μg Histone H3 (D2B12) XP® Rabbit mAb (CST, Cat. No.4620) and 4 μg anti-E2F1 (Proteintech, Cat. No. 66515-1-Ig) antibody. After that, the eluted DNA fragment was detected with the primers specific for BIRC5 promoter and SYBR premix (Vazyme).
6
Quantitative RT-PCR Analysis of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIZOL (TAKARA, 9109, Japan) and reverse transcribed with the High Capacity cDNA Reverse Transcription kit (ABI, 4368814, USA). Real-time quantitative polymerase chain reaction was performed as reported in a previously published paper [22 (link)], using SYBR Premix (Vazyme, Q331-02, China) according to the manufacturer’s instructions in an ABI StepOnePlus instrument. The data were analyzed via the ΔΔCt method and normalized to 18S mRNA. All primer sequences were designed by Primer3Plus (http://www.primer3plus.com/ ) and are listed in the Supplementary information.
7
BT549 and MDA-MB-231 Cell RNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell RNA of BT549 and MDA‐MB‐231 was extracted with Trizol reagent (Sigma, Cat. No. T9424‐100m) and reverse‐transcribed to cDNA by Hiscript QRT supermix (Vazyme, Cat. No. R123‐01), respectively. The qPCR was accomplished using SYBR premix (Vazyme) and primer (Table S3 ). Finally, the relative mRNA expression of NCAPD2/CDK1 was accessed by 2−△△Ct.
8
Emodin and Gemcitabine Cytotoxicity Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Emodin stock solution (Sigma-Aldrich; Merck KGaA) was dissolved in DMSO. Gemcitabine stock solution (Eli Lilly and Company) was dissolved in 0.9% sodium chloride. Total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Reverse-transcribed complementary DNA was synthesized using the PrimeScript RT reagent kit (Vazyme Biotech Co., Ltd.). Real-time polymerase chain reaction was performed using SYBR Premix (Vazyme Biotech Co., Ltd.) on a StepOne RealTime PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers used were synthesized by Genomics Co. The sequences of the primers used for reverse transcription-quantitative (RT-q) PCR are listed in Table I . Rabbit anti-human anti-P-glycoprotein (P-gp) antibody (cat. no. 250820) was purchased from Abbiotec, and mouse anti-human MRP1 monoclonal antibody (cat. no. ab24102), goat anti-human MRP5 polyclonal antibody (cat. no. ab24107) and rabbit anti-human Ki-67 (cat. no. ab197234) were purchased from Abcam. Goat Anti-Rabbit secondary antibody (cat. no. ab205718) was purchased from Abcam.
9
Quantitative RT-PCR of Gapdh and Chi3l1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using MolPure® TRIeasy Plus Total RNA Kit (Catalog No. 19211ES60, YEASEN, China). RNA concentration was measured by Nanodrop (Thermo ScientificTM, USA), and each paired sample was adjusted to the same concentration. For reverse transcription (RT), we used an RT reagent kit purchased from Vazyme (Catalog No. R323-01, China). Real-time PCR was subsequently performed using SYBR Premix supplied by Vazyme (Catalog No. Q711-02, China) on the Applied Biosystems Quantstudio 5 and Quantstudio 6 Flex (Thermo Fisher, USA). The primers were synthesized by Tsingke (China), and the following primer sequences were used:
Gapdh-F: 5′- AGGTCGGTGTGAACGGATTTG -3’
Gapdh-R: 5′- TATGGTTTTGACGACTGTGTGAT -3’
Chi3l1-F: 5′- CTGCGTACAAGCTGGTCTG -3’
Chi3l1-R: 5′- TGGATGGCGTCTGGTAAGAAG -3’
Gapdh-F: 5′- AGGTCGGTGTGAACGGATTTG -3’
Gapdh-R: 5′- TATGGTTTTGACGACTGTGTGAT -3’
Chi3l1-F: 5′- CTGCGTACAAGCTGGTCTG -3’
Chi3l1-R: 5′- TGGATGGCGTCTGGTAAGAAG -3’
10
Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were isolated using Trizol (TakaRa, Otsu, Japan), and the final concentrations were measured by NanoDrop 2000 (Thermo, Waltham, MA, USA). The cDNA was synthesized using a reverse transcription kit (TakaRa, Otsu, Japan). We used real-time quantitative PCR for mRNA analysis, and every reaction was performed in triplicate using a SYBR Premix (Vazyme, Nanjing, China) on a StepOne Real-Time PCR Machine (ABI, Carlsbad, CA, USA). The relative level of mRNA was normalized to that of β-actin and calculated using the 2-∆∆Ct algorithm. Primer sequences used for RT-qPCR are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!