For real-time quantitative reverse transcription PCR (qRT-PCR), the seedlings, vertically grown on MS medium for 7 days, transferred to new MS medium with or without 1 μM estradiol (10 mM stock in EtOH), incubated vertically at 23 °C under continuous light for additional 3 days, were used. Total RNA was extracted with an RNeasy Plant Mini Kit (Qiagen). Complementary DNA (cDNA) was synthesized from 0.5 mg of total RNA treated by ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) according to the manufacturer’s instructions. KAPA SYBER FAST qPCR Kit was used for the preparation of real-time qPCR mix, and then real-time qPCR was performed using the LightCycler 96 Real-Time PCR System. Based on the results of three technical repeats for three biological replicates, mesenger RNA relative expression levels (in arbitrary units) were determined using standard curves for LZY3-mCherry and ACT8 generated by serial dilutions of cDNA. For semi-quantitative RT-PCR, cDNA was synthesized from 1 µg of total RNA from 10-day-old seedlings with ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) according to the manufacturer’s instructions. ACT8 was used as an internal control. All primer sequences are listed in the Supplementary Table 4 .
Gdna remover
Manufactured by Toyobo
Sourced in Japan, United States, China
The GDNA Remover is a laboratory equipment designed to remove genomic DNA from samples. It functions by selectively binding and removing unwanted genomic DNA, leaving other biomolecules such as RNA or proteins unaffected.
Automatically generated - may contain errors
Lab products found in correlation
Revertra ace qpcr rt master mix, by Toyobo (215 mentions)
Thunderbird sybr qpcr mix, by Toyobo (72 mentions)
Trizol reagent, by Thermo Fisher Scientific (60 mentions)
Rneasy mini kit, by Qiagen (33 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (29 mentions)
Trizol, by Thermo Fisher Scientific (21 mentions)
Rnaiso plus, by Takara Bio (16 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (12 mentions)
Lightcycler 480, by Roche (10 mentions)
Kod sybr qpcr mix, by Toyobo (9 mentions)
Isogen 2, by Nippon Gene (9 mentions)
Tri reagent, by Molecular Research Center (8 mentions)
Thermal cycler dice real time system, by Takara Bio (8 mentions)
Revertra ace qpcr master mix, by Toyobo (8 mentions)
Isogen, by Nippon Gene (8 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (8 mentions)
Rneasy plant mini kit, by Qiagen (7 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (7 mentions)
Steponeplus, by Thermo Fisher Scientific (7 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (7 mentions)
282 protocols using gdna remover
1
Quantitative Real-Time RT-PCR Analysis
2
Transcriptional Responses to Zinc Deficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Seedlings (12 d old) of the four accessions were exposed to either 0 μM (–Zn treatment) or 0.4 μM (+Zn treatment) in half-strength Kimura B solution for 3 d before sampling. For RNA extraction, the plants were divided into roots, the shoot basal region (0.5 cm, including basal nodes), and the rest of the shoot. Total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA remover (Toyobo) following the manufacturer’s protocol. The cDNAs were amplified using SsoFast EvaGreen Supermix (Bio-Rad) and quantitative real-time PCR was performed on a Bio-Rad CFX384 using specific gene primers for OsZIP4, OsZIP5, OsZIP8, OsZIP9, and OsZIP10. OsHistoneH3 was used as an internal standard. The relative expression was normalized using the 2−ΔΔCt method using the CFX Manager software (Bio-Rad). The primers are listed in Supplementary Table S1 at JXB online.
3
Quantitative RT-PCR Analysis of S. elongatus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RelQ cells were cultured and harvested as described above. Total RNA was extracted from S. elongatus PCC 7942 frozen cells using an RNeasy Mini Kit (Qiagen) and ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). qPCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO) and Mx3000P qPCR Systems (Agilent Technologies) according to the manufacturer’s instructions. The primers used to amplify the selected genes by qRT-PCR are listed in Supplementary Table 1 . The mRNA levels shown are the average of two independent measurements and were normalized to those of the rnpB-encoding RNA subunit of RNase P or the gene encoding rimM encoding ribosome maturation factor (reference genes), whose transcript levels did not change with ppGpp accumulation.
4
Mating-induced Transcriptome Changes in Flies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify mating-induced changes in gene expression, the middle midguts from 5 to 10 adult female flies were dissected. Total RNA was extracted using RNAiso Plus reagent (TaKaRa). cDNA was prepared with ReverTra Ace qPCR RT Master Mix with gDNA Remover (ToYoBo). Quantitative reverse transcription PCR (qRT-PCR) was performed using the Universal SYBR Select Master Mix (Applied Biosystems) with a Thermal Cycler Dice TP800 system (TaKaRa). Serial dilutions of a plasmid containing the open reading frame of each gene were used as standard. The amount of target RNA was normalized to ribosomal protein 49 (rp49) and then relative fold changes were calculated. The following primer pairs were used to measure transcript level: rp49 forward, 5ʹ-CGGATCGATATGCTAAGCTGT-3ʹ and reverse, 5ʹ-GCGCTTGTTCGATCCGTA-3ʹ; NPF forward, 5ʹ-CTCCGCGAAAGAACGATGTCAACAC-3ʹ and reverse, 5ʹ-CCTCAGGATATCCATCAGCGATCCG-3ʹ; NPFR forward, 5´-GATCCTGTCCAAGTACTGGCCCTAC-3´ and reverse, 5´-ACGATCACCTGATATCTGTCGAAGGC-3´. All qRT-PCR runs were performed in triplicate.
5
Quantitative Real-Time PCR Protocol for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from 500 ng of total RNA using ReverTra Ace quantitative reverse transcription‑polymerase chain reaction (qPCR) RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan) according to the manufacturer's protocol. qRT-PCR was performed in triplicate using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems, Wilmington, MA, USA) and CFX 96 Connect Real-Time System (Bio-Rad Laboratories Inc., Hercules, CA, USA). Thermocycling conditions were 3 min at 95 °C, followed by 40 cycles of 95 °C for 3 s and 60 °C for 20 s. Changes in relative gene expression between cDNA samples were determined using the 2−ΔΔCq method40 (link). The primers used in this study are listed in Supplementary Table S2 .
6
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extracted with RNeasy Mini Kit (Qiagen, Chatsworth, CA, USA) from the liver and kidneys was transcribed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (FSQ30, Toyobo, Osaka, Japan). Quantitative PCR was performed using THUNDERBIRD Probe qPCR Mix (Toyobo) and StepOne plus (Thermo Fisher Scientific, Waltham, MA, USA) as described previously [4 (link),46 (link)], and the Taqman probes used are listed in Supplemental Table S1 . The values obtained were used in the ΔΔCt method of relative quantification with normalization to 18S gene expression.
7
Quantitative Real-Time PCR Analysis of NMU and NMUR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from the NAc, CPu, BLA, and hypothalamus (Hypo) by using an RNeasy mini kit (Qiagen) or TRIzol reagent (Invitrogen). First-strand cDNA synthesis was performed by using a ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo). Total RNA (250 ng) was subjected to quantitative real-time PCR performed with a SYBR Fast qPCR Kit (KAPA Biosystems, Wilmington, MA, USA) on a Light Cycler PCR platform (Roche Diagnostics, Basel, Switzerland). Primers used for qPCR are listed in Table 1 . PCR was performed by using the following protocol: 95 °C for 3 min, followed by 45 cycles in total at 95 °C for 10 s and 60 °C for 30 s, then 72 °C for 1 s. Generation of specific PCR products was confirmed by melting curve analysis and DNA gel electrophoresis. Data were analyzed by using the ΔΔCt method, with normalization against GAPDH mRNA expression.Table 1
Primers used in the present study.
| Genes (Genbank Accession number) | Primers | Product length (bp) | |
|---|---|---|---|
| NMU ( | Forward | 5′-GTCCTCTGTTGTGCATCCGTT-3′ | 130 |
| Reverse | 5′-GCGTGGCCTGAATAAAAAGTA-3′ | ||
| NMUR1 ( | Forward | 5′-CGTCATCCTGCGCAACAAG-3′ | 223 |
| Reverse | 5′-CACACTCAGGGCTGTGACAT-3′ | ||
| NMUR2 ( | Forward | 5′-TGTCACCACGGTTAGCATTGA-3′ | 218 |
| Reverse | 5′-GTTTGGTGACTGTGCAGGTG-3′ | ||
| GAPDH ( | Forward | 5′-CGTCCCGTAGACAAAATGGT-3′ | 177 |
| Reverse | 5′-GAATTTGCCGTGAGTGGAGT-3′ | ||
8
Quantification of Osteoclast Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative expression levels of mRNA were measured by qRT-PCR. Total RNA samples extracted from BMMs and OCs were subjected to complementary DNA construction using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Tokyo). qRT-PCR was performed on MX3000P (Agilent Technologies, Santa Clara, CA) using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) and the corresponding primer set. The relative expression level of each gene expression was calculated by the 2-ΔΔCt method52 (link). Gapdh was used as an internal control. The primer set sequences used for qRT-PCR are listed in Table 4 .
Primer sequence sets used for quantitative RT-PCR
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Gapdh | 5ʹ-TCCCACTCTTCCACCTTCGA-3ʹ | 5ʹ-TAGGGCCTCTCTTGCTCAGT-3ʹ |
| Acp5 | 5ʹ-CATACGGGGTCACTGCCTAC-3ʹ | 5ʹ-AGGGATCCATGAAGTTGCCG-3ʹ |
| Ctsk | 5ʹ-AGTGTTGGTGGTGGGCTATG-3ʹ | 5ʹ-GGCTGGCTGGAATCACATCT-3ʹ |
| Oscar | 5ʹ-ACACCTGGCACCTACTGTTG-3ʹ | 5ʹ-TGGGTATAGTCCAAGGAGCCA-3ʹ |
| Mmp9 | 5ʹ-GCGTGTCTGGAGATTCGACT-3ʹ | 5ʹ-TGGAAACTCACACGCCAGAA-3ʹ |
| HtrA1 | 5ʹ-CCAAAGAGCTGAAGGACCGT-3ʹ | 5ʹ-TGACCACAGACTGTCCGTTG-3ʹ |
| HtrA2 | 5ʹ-CTGGTGGTCCCCTGGTTAAC-3ʹ | 5ʹ-TCCCCAATGGCCAAGATCAC-3ʹ |
| HtrA3 | 5ʹ-GGACCATCACGCCAAGTTTG-3ʹ | 5ʹ-CGGCCATTGACTTTGACGATG-3ʹ |
| HtrA4 | 5ʹ-ACCTGGGTCTTCGAATGCTG-3ʹ | 5ʹ-GGTTGCCCGTTTATGCTGAC-3ʹ |
9
Quantifying AR-FL and AR-V7 Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using an RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA was converted into cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). Transcript expression was measured by Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) using a 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). The transcript levels were normalized according to the levels of HSPA8. Data were obtained from three independent biological experimental replicates with three technical replicates. Primer sequences for real‐time PCR were as follows: AR‐FL forward 5ʹ‐ACATCAAGGAACTCGATCGTATCATTGC‐3ʹ, reverse 5ʹ‐TTGGGCACTTGCACAGAGAT‐3ʹ; AR‐V7 forward 5ʹ‐CCATCTTGTCGTCTTCGGAAATGTTATGAAGC‐3ʹ, reverse 5ʹ‐TTTGAATGAGGCAAGTCAGCCTTTCT‐3ʹ; and HSPA8 forward 5ʹ‐ACCTACTCTTGTGTGGGTGTT‐3ʹ, reverse 5ʹ‐GAGATAGCTTGGAGTGGTTCG‐3ʹ.
10
Quantitative PCR Analysis of Mouse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from mouse tissues using TRI Reagent (Molecular Research Center, Inc.). cDNA was prepared using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Japan) according to the supplier’s protocol. Real-time PCR was carried out using THUNDERBIRD SYBR qPCR Mix (Toyobo) on Thermal Cycler Dice Real Time System II (Takara Bio). Quantification was done by Delta Delta Ct method, and Rpl13a gene was used as a reference gene. Primers used in qPCR are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!