Total RNA was extracted using RNeasy Plus Mini kit (Qiagen) according to the manufactuer's instruction. Total RNA was reverse transcribed into cDNA using GoScriptTM Reverse Transcription Kit (Promega). Then, quantitative real-time PCR was performed using FastStart SYBR Green Master mix (Roche) and Bio-rad S1000 Thermocycler with the indicated primers (Supplementary Tables 1 and 2 ). GAPDH was used as a reference gene and the results were presented as relative expressions to control.
Goscript reverse transcription kit
Manufactured by Promega
Sourced in United States, China, United Kingdom, Switzerland
The GoScript Reverse Transcription Kit is a laboratory product designed for the conversion of RNA to complementary DNA (cDNA). It contains the necessary components, including the GoScript Reverse Transcriptase enzyme, to facilitate this process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (43 mentions)
Trizol, by Thermo Fisher Scientific (20 mentions)
Gotaq qpcr master mix, by Promega (12 mentions)
Sybr green, by Bio-Rad (11 mentions)
Dnase 1, by Thermo Fisher Scientific (7 mentions)
Nanodrop, by Thermo Fisher Scientific (6 mentions)
Faststart sybr green master mix, by Roche (6 mentions)
Rneasy mini kit, by Qiagen (6 mentions)
Rnaiso plus, by Takara Bio (6 mentions)
Rneasy kit, by Qiagen (6 mentions)
Trizol reagent, by Takara Bio (6 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Dntps, by Thermo Fisher Scientific (6 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (6 mentions)
Eastep super rna extraction kit, by Promega (5 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (5 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (5 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Tri reagent, by Merck Group (4 mentions)
S1000 thermocycler, by Bio-Rad (4 mentions)
187 protocols using goscript reverse transcription kit
1
Total RNA Extraction and qRT-PCR Analysis
2
Analysis of LXR-Mediated Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were plated in 6 well plates (2.5 × 105 cells/well) and incubated overnight before treatment with vehicle (ethanol) or LXR ligands. mRNA analysis was performed as described previously [43 (link),44 (link)]. Briefly, Promega ReliaprepTM RNA Cell Miniprep System was used for the RNA extraction (Promega, Southampton, UK, Cat: #Z6012), and product guidelines were followed using approximately 5 × 105 cells (allowing for doubling time). On column DNase 1 digestion was performed and RNA was eluted in 30 μL water. Purified RNA was stored at −80 °C. The GoScriptTM Reverse Transcription kit (Promega, Cat: A5003) was used for the cDNA synthesis, and product guidelines followed using 500 ng total RNA/reaction and x random primers. The resulting cDNA was then diluted 1 in 5 in water and stored at −20 °C. Taqman Fast Advanced Mastermix (Thermo Fisher, Paisley, UK, Cat: 4444557) was used with Taqman assays (Thermo Fisher, Paisley, UK, Cat: 4331182) on a QuantStudio Flex 7 (Applied Biosystems Life Tech, Thermo Scientific) for gene expression experiments. Taqman assays (Hs02800695_m1–HPRT1, Hs01059137_m1–ABCA1, Hs00171168_m1–APOE) and Mastermix were stored at −20 °C. Gene expression was analysed using the ΔΔCt method and normalised to the housekeeping gene HPRT1.
3
RNA Extraction and RT-PCR for 16S rRNA Gene Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the RNeasy® Mini Kit (Qiagen) or the RNeasy® PowerSoil® Total RNA Kit (Qiagen). Both kits were used according to the manufacturer’s standard protocols. RNA extractions were subjected to a RT-PCR protocol using random hexamers as primers and a PTC-200 Peltier Thermal Cycler (MJ Research). The GoScriptTM Reverse Transcription kit (Promega), as well as the Invitrogen™ ThermoScript™ RT-PCR System for First-Strand cDNA Synthesis (Thermo Fisher Scientific) were used. RT-PCR products (cDNA) underwent a standard PCR protocol, along with an RNA control, to assess product for DNA contamination. DNA contaminated samples were treated with Ambion DNase (see above) and re-run through the RT-PCR protocol. Primers for the 16S rRNA gene (27 F and 357 R) were used for amplification and the procedure was again run on an Applied Biosystems GeneAmp PCR System 9700 Thermal cycler.
4
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment, BMDMs or TAMs were collected, washed twice with PBS and suspended directly in TRI reagent (Thermo Fisher Scientific). Total RNA was isolated following the manufacturer’s instructions. The concentration of RNA was determined using a Qubit 4 Fluorometer (Thermo Fisher Scientific), a Qubit RNA Broad Range Assay Kit (Invitrogen; Q10210), and a Nanodrop (Thermo Fisher Scientific). Reverse transcription of RNA was performed using the GoScriptTM Reverse Transcription Kit (Promega) with 1 μg of total RNA. The mRNA levels of the target genes were assessed using Luna Universal qPCR Master Mix (New England Biolab; M3003E) on a Bio-Rad CFX96 real-time system. The quantification of mRNA expression was performed via the comparative Ct (2-∆∆Ct) method. The Rps9 gene was used as the internal control. The primer pair sequences used are listed in Supplementary Table S2 .
5
Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and purified from peanut roots using the RNAiso Pure Plant Kit (TAKARA, Beijing, China) and then examined for total RNA by ultra-micro UV spectrophotometer (IMPLEN-N50, Thermo Scientific, USA) and 2% agarose gel electrophoresis (D50-UVIPURE, UVITE, UK; EPS300, Tanon, China) to check the quantity and quality of total RNA. Then, the total RNA was converted to complementary DNA (cDNA) by the GoScriptTM Reverse Transcription kit (Promega, USA) for subsequent RT-qPCR analysis. Primers were designed by Primer 3.0 and Primer 5.0 software, and the target gene sequences were found on NCBI’s GeneBank. RT-qPCR analyses were performed in the same manner as described in WEI [35 (link)], and the 2−ΔΔCT calculated results [36 (link)] were obtained with this method with three replicates per treatment.
6
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the indicated cells or mouse colon tissues with TRI reagent (Sigma) according to the manufacturer’s instructions. RNA samples were reverse-transcribed into cDNA with a GoScriptTM Reverse Transcription kit (Promega). The cDNA samples were amplified by real-time PCR with a SYBR Green kit (Toyobo) on an ABI 7900 HT Fast Real-Time cycler (Applied Biosystems). The expression of target genes was normalized to expression of housekeeping gene beta actin. In Figs. 2 h and 6h , arbitrary units (AU) were introduced to normalize the difference between different batches of samples. Primers used were listed in Supplementary Table 3 .
7
Identifying Sfdsx in S. frugiperda
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of day one third-instar S. frugiperda was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized using a GoScriptTM reverse transcription kit (Promega, Madison, WI, USA) according to the manufacturers’ instructions. The dsx of S. frugiperda was identified through blast against the amino acid sequences of D. melanogaster (GenBank accession number NP_001287220.1) and B. mori (GenBank accession number NP_001036871.1) against S. frugiperda in NCBI. Primers were designed using the Primer 3 website (https://primer3.ut.ee , accessed on 1 May 2000) to amplify exons 2 to 5 flanking the coding regions of female- and male-specific regions of Sfdsx (Table S1 ).
8
Regulation of Renal Fibrosis by miR-4709-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HK-2 cells transfection was done using miR-4709-3p mimics or inhibitors for 6 hours and later exposed to TGF-β1 (5 ng/ml) for 48 hours. The total RNA was then extracted from HK-2 cells using TRIzol reagent (Invitrogen/Thermo Fisher Scientific) following the manufacture’s guideline. cDNAs processing was done by the reverse transcription of RNA using the GoScriptTM Reverse Transcription kit (Promega). Later, qPCR was analyzed using the SYBR® Premix Ex Taq™ II (Takara, Japan). GAPDH and U6 were utilized as the analysis normalization for the abundances of miR-4709-3p and other mRNAs, respectively, as used elsewhere36 (link). The primers’ sequences are described in Table 2 . All experiments were carried out in triplicates, and mRNA expressions were determined by the 2−ΔΔCt method.
List of primers used in this study
| List of Primers used in this study | ||
|---|---|---|
| Gene | Forward Primer | Reverse Primer |
| Hsa-α-SMA | AAGAGCATCCCACCCTGC | TAGCCACATACATGGCTGGG |
| Hsa-FN | ACAACACCGAGGTGACTGAG | GGACACAACGATGCTTCCTGA |
| Hsa-Col1 | GTGGATACGCGGACTTTG | TCCATCATACTGAGCAGCA |
| Mmu-α-SMA | CCAACCGGGAGAAAATGA | CAGACGCATGATGGCAT |
| Mmu-FN | GTCTCCTGGGAGAGGAGC | TGATCAGCATGGACCACT |
| Mmu-Col1 | GGTCCTGATGGCAAAAC | TCCATCTTTGCCAGCAGGA |
| LATS2 | AGGCCAAAGACTTTTCCTGC | CACGTACACAGGCTGGCAGC |
| Mmu-β-Actin | CAGCTGAGAGGGAAATCGTG | CGTTGCCAATAGTGATGACC |
| Hsa-β-Actin | ACCATTGGCAATGAGCGGTTC | GGTCTTTGCGGATGTCCACGT |
| miR-4709-3p | Qiagen (Cat#MS00039914) | |
| snRNA RNU6B | Qiagen (Cat#MS00033740) | |
9
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the Trizol (RNAiso Plus, TaKaRa Cat No. 9108), and DNA contamination was removed using RQ1 RNase-Free DNase (Promega Cat No. M6101). The first-strand cDNA was synthesized using the GoScriptTM Reverse transcription kit (Promega Cat No. A2709). Real-time PCR was performed using qPCR Master Mix (Promega Cat No. LS2062) in a LightCycler 480 thermocycler (Roche, Basel, Switzerland). The gene-specific primer sequences are listed in Supplemental Table S1 .
10
Quantifying Inflammatory Cytokine Expression in Mouse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ZIV tissue samples were dissociated from three CFA1D and saline1D mice. Total RNA was isolated and purified using the RNeasy kit (Qiagen), followed by reverse transcription using a Go-ScriptTM Reverse Transcription kit (Promega, A5001). Quantitative real-time PCR (qPCR) from 1 to 10 ng of cDNA templates was performed using an SYBR Green kit (GeneStar, Baltimore, MD, United States) on an ABI Step one system (Applied Biosystems, Waltham, MO, United States). Gapdh mRNA quantification was used as a loading control for normalization. Fold changes of mRNA levels over controls were calculated by the 2–ΔΔCT method using Gapdh as control. Each real-time PCR reaction was run in triplicates on a 96-well plate, and water was used as a negative control. Sequences of the primers (Sangon Biotech, Shanghai, China) used in PCR are listed as follows: TNFα (forward 5′-CCTGTAGCCCACGTCGTAG-3′, reverse 5′-GGGAGTAGACAAGGTACAACCC-3′); IL-1β (forward 5′-TTCAGGCAGGCAGTATCACTC-3′, reverse 5′-GAAGGTCCACGGGAAAGACAC-3′); or IL6 (forward 5′-GCCAACATTTTATTTCCGGGA-3′, reverse 5′-CCACTGAGCATATTTCTCGGG-3′).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!