Hiscript 2

Total RNA was isolated from tissues and cells by using Trizol reagent (Invitrogen, USA) according to the manufacturer’s protocol. cDNA was synthesized using HiScript II (Vazyme, China) and qRT-PCR for mRNA and miRNA was performed on StepOne Plus Real-Time PCR system (Applied Biosystems, USA) or LightCycler 480 (Roche, USA). U6 and β-actin were used as an internal standard control for miRNA and mRNA detection, respectively. Each sample was replicated three times and data was analyzed by comparing Ct values. All PCR primers were purchased from GeneCopoeia (Guangzhou, China)and listed in Additional file 2: Table S2.

RNA was extracted from tissues and cells using Trizol reagent (Ambion Inc, Austin, TX, USA) following the manufacturer’s protocol. Subsequently, cDNA was synthesized with HiScript II (Vazyme Biotech, Nanjing, China) and RanGAP1 expression levels were quantified by qPCR using a Mx3005P instrument (Agilent Technologies, California, USA) and SYBR Green qPCR Master Mix (Servicebio). GAPDH served as the internal control for mRNA analysis. The primer sequences pertaining to the research are presented in Table S3.

P. aeruginosa strains were grown in LB medium and harvested until grown to OD₆₀₀ = 1. RNA was isolated using the TRIzol RNA purification kit (12183555, Invitrogen) following the manufacturer’s instructions. Total cDNA was synthesized by the HiScript II reverse transcriptase (Vazyme). RT-qPCR was performed by using the SYBR Green Realtime PCR master mix and the StepOnePlus real-time PCR system (ABI). For calculation the relative expression levels of tested genes, rplS was used as the reference gene. All experiments were repeated three times.

The total RNA from ccRCC tissues and adjacent normal tissues was acquired using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) on the basis of a standard extraction protocol. The cDNA was synthesized by HiScript II (Vazyme, China), and qPCR analysis was performed on StepOne Plus Real-Time PCR system (Applied Biosystems, USA). The initial reaction was incubated at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min in accordance with the SYBR green method. The relative expression levels were analyzed by comparing 2^−ΔΔCT method. All reactions were carried out in triplicate. Actin was used for the internal reference. Primers were synthesized by TSINGKE (Beijing, China), including Actin (F:5’ ATGACTTAGTTGCGTTACACC 3’, R:5’ GACTTCCTGTAACAACGCATC 3’) and METTL14 (F:5’ TTTCTCTGGTGTGGTTCTGG 3’, R:5’ AAGTCTTAGTCTTCCCAGGATTG 3’). Six paired tumor tissues and their adjacent normal tissues were obtained from ccRCC patients from Affiliated Hospital of Nantong University. Ethical approval was obtained from the Institutional Research Ethics Committees of Affiliated Hospital of Nantong University and informed written consent was obtained from all of subjects.