Qubit fluorometric quantification system

Lung macrophages from PBS- and GEM-treated tumor-free mice were sorted, and RNA was extracted using a QIAGEN RNeasy Kit. The quantity of the purified RNA samples was measured by the RNA High Sensitivity Kit in the Qubit fluorometric quantification system (Thermo Fisher Scientific). Libraries were prepared using the Universal Plus mRNA-Seq with NuQuant (NuGEN). The pooled library was run on MiSeq to test quantity and quality using the MiSeq Reagent Nano Kit V2 300 cycles (Illumina). Sequencing was performed on the Illumina NextSeq 500 using the NextSeq 500/550 75 cycle High Output Kit v2.5. Differential expression was performed using 2 tools, DESeq2 and Cuffdiff2. DEGs at P value cutoff 0.01, or q value cutoff of 0.01 with log₂ fold-change of 0 for the pairwise comparisons, were used for further analysis of enriched GO biological processes. A volcano plot was created to examine the distribution of log₂ fold-change at different significance levels. RNA-Seq data were deposited with National Center for Biotechnology Information Gene Expression Omnibus accession GSE217105.

DNA was extracted from FFPE tissues using the DNA BLOOD Mini KIT (Qiagen). Samples were incubated with proteinase K (Qiagen, Hilden, Germany) for 72 h at 56 °C and subsequently processed according to the manufacturer’s instructions. DNA concentrations were measured using the Qubit Fluorometric quantification system (Thermo Fisher Scientific, Waltham, MA, USA).

Nontherapeutic NHF1s were harvested using 0.05% trypsin and counted (ThermoFisher Countess II). Next, cells were resuspended to obtain 5 × 10⁴, 1 × 10⁵, 5 × 10⁵, 1 × 10⁶, 2 × 10⁶, and 3 × 10⁶ cells per tube, and genomic DNA was extracted from each tube per manufacturer's protocol (ThermoFisher K182002). DNA was quantified using a Qubit Fluorometric Quantification system (ThermoFisher). Each cell concentration was quantified in triplicate to create a standard curve. To quantify seeding efficiency, nontherapeutic iNSCs were encapsulated in FLOSEAL® as described above, but not polymerized with fibrinogen. The scaffold mixture was divided into six tubes and DNA was isolated. This experiment was done in triplicate to produce a total of 18 scaffold samples.

Qiagen AllPrep DNA/RNA FFPE Kit was used for RNA extraction following the manufacturer’s protocol. RNA quantity was measured with the Qubit fluorometric quantification system (Life Technologies). Before library preparation, cDNA was synthesized from all RNA samples and a control PCR for quality assessment was performed. Although the library preparation kit requires a Ct value of <27, we had to include samples with Ct values of 27-30 because the cases did not have any other tissue samples. After the QC PCR run, cDNA library was prepared with the Archer FusionPlex Sarcoma kit (ArcherDX, Boulder, CO) following the manufacturer’s protocol. Libraries were run on the Illumina NextSeq 500 with compatible flow cells. All the analyses were done by using the ArcherDx Analysis software (version 6.2.7) and variants were confirmed with publicly available somatic variant databases.

Progeny seed was sterilized as described above and plated via pipette on to ½ MS media +1% agar, and grown to the two‐leaf stage. A set of standards was created by producing mixes of confirmed transgenic or WT seedlings to result in batches of 100 seedlings with 0% transgenic, 10%, 20%, 50%, and 100% transgenic plants. Seedlings were harvested in batches of 100, weighed, and flash frozen in liquid nitrogen. DNA extraction was performed using the Wizard^® Genomic DNA Purification kit (Promega Corporation, Madison, WI, USA) according to the manufacturer's instructions. DNA quality was confirmed via gel electrophoresis, and DNA quantity was calculated using the Qubit^® fluorometric quantification system (Life Technologies Corporation, Invitrogen™, Grand Island, NY, USA). The qPCR was performed using primers for the NPTII gene on a Stratagene Mx4000 (now Agilent Technologies Inc., Santa Clara, California) (forward 5′‐ CGGCTGCATACGCTTGATC‐3′ and reverse 5′‐GATGCGATGTTTCGCTTGGT‐3′) and SYBR^® Green master mix (Life Technologies Corporation, Applied Biosystems^®, Grand Island, NY, USA). Transgene frequency within the mixed populations was calculated by comparison of each replicates Ct values to the standard curve of Ct values established from the known transgene frequency standards.