3730 dna analyser

To further confirm the identification, DNA was extracted from a single leg using a Qiagen DNeasy® Blood and Tissue kit (Manchester, UK) according to the manufacturer’s instructions and amplified by PCR. Target amplification was carried out using Phusion® high-fidelity polymerase (New England Biolabs. Hitchin, UK) on the internal transcribed spacer 2 (ITS2) of ribosomal DNA (rDNA), and the mitochondrial cytochrome oxidase I (cox1) region using the following 5′-TGT GAA CTG CAG GAC ACA TG-3′ (ITS2 forward) and 5′-ATG CTT AAA TTT AGG GGG TA-3′ (ITS2 reverse) primers of Walton et al. [13 (link)], and 5′-GGT CAA CAA ATC ATA AAG ATA TTG G-3′ (cox1 forward) and 5′-TAA TAT GGC AGA TTA GTG CAT TGGA-3′ (cox1 reverse). The PCR products were purified using the ThermoFisher Scientific GeneJET Purification Kit(Paisley, UK), and amplification success was confirmed by gel electrophoresis. The products were subsequently sequenced using an Applied Biosystems 3730 DNA Analyser with BigDye v. 3.1 (University of Shuffled, Core Genomic Facility). The sequences were then blasted in GenBank® for sequence similarity matches [14 ]. DNA sequencing was replicated five times for ITS2 and three times for cox1 regions to remove discourse through PCR error.

Briefly, for whole-exome sequencing, the sample library was prepared using Illumina Nextera Rapid Capture kits with paired-end sequencing performed using the Illumina HiSeq2000 (Illumina). The sample was sequenced to an average coverage of 39.42 reads with a mean read length of 177.23 bp (Supplemental Table S2). All reads were subsequently aligned using BWA (Li and Durbin 2009 (link)) against UCSC hg19 reference genome. Variant calling and quality-based filtering for all samples were done using GATK (McKenna et al. 2010 (link)). Variants were annotated with ANNOVAR (Wang et al. 2010 (link)) with allele frequency data from the gnomAD browser, as well as with predicted impact of variants (Kircher et al. 2014 (link)).
For Sanger sequencing, exon 20 was amplified using specific primers (F 5′-CAGCTTCCAGTGGAATCAAACA-3′ and R 5′-AGGCATCACAGATACACAATCA-3′). The amplified PCR product was enzymatically cleaned up and sequenced on both strands using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems). Sequencing products were run on a 3730 DNA Analyser (Applied Biosystems) and analyzed using Sequencher DNA Sequence Analysis software (Gene Codes Corp.).

ICLN was tested for MAP infection by PCR for IS900. Two independent primer sets were used [32 (link), 33 (link)]; set 1 (for: GTTCGGGGCCGTCGCTTAGG; rev: GCGGGCGGCCAATCTCCTT) and set 2 (for: CTGGCTACCAAACTCCCGA; rev: GAACTCAGCGCCCAGGAT) generated products of 99 bp and 314 bp respectively. Genomic DNA (gDNA) was purified using the Wizard^® Genomic DNA Purification Kit (Promega, UK). All reactions used FastStart Taq DNA Polymerase (Roche Diagnostics, UK) following the manufacturer’s instructions, with 500 ng of gDNA and 0.2 μM of each primer. PCRs used a Veriti^® Thermal Cycler (Applied Biosystems, UK) with four reactions performed for each primer set at four different annealing temperatures. PCR parameters were: 5 min at 95 °C, then 35 cycles of 15 s at 95 °C, 15 s at 55 °C, 58 °C, 60 °C, or 62 °C, and 30 s at 72 °C, with final elongation of 10 min at 72 °C. PCR products were separated by 2% agarose gel electrophoresis, purified with a MinElute Gel Extraction Kit (Qiagen, UK); cloned using a TOPO TA cloning kit (Invitrogen, UK) and sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit and 3730 DNA Analyser (Applied Biosystems). The presence of an amplicon, confirmed by sequencing, from either primer set was taken as a positive indication for the presence of MAP; the absence of an amplicon in all PCR reactions was confirmation of absence of MAP infection.

T. cruzi TcSC5D gene encodes a putative C-5 sterol desaturase (TcCLB.473111.10, TcCLB.507853.10), this was amplified by PCR followed by direct sequencing to determine DTU-specific genotypes using eight key discriminating single nucleotide polymorphisms (SNP’s) as previously described [64 (link)]. Briefly, a 832bp TcSC5D fragment was amplified under the following PCR conditions: 50 pmol TcSC5D-forward (5´-GGACGTGGCGTTTGATTTAT-3´) & reverse primers (5´-TCCCATCTTCTTCGTTGACT-3´), 100 ng genomic DNA, Platinum PCR Supermix High Fidelity (ThermoFisher Scientific) in a final volume of 50 μl. Samples were denatured at 94°C for 5 min, followed by 35 cycles at 94°C 30 s, 58°C 30 s, 72°C 30 s, and extension at 72°C for 5 min. Amplification products were visualised on 1.2% agarose with ethidium bromide as a single 832 bp product, and subsequently sequenced with the same PCR primers using Applied Biosystems 3730 DNA Analyser. Chromatograms were analysed using Chromas software and alignments generated using Clustal Omega to identify nucleotides at key position 138, 168, 336, 495, 618, 648, 657 and 747 and determine DTU assignment TcI-VI (S1 Table).

We also screened all individuals at eight microsatellite loci (AG5, BbH08, BbA10, AC1, 470AG1, M201, 69TGA1, BbB19) described previously [10 (link)-12 (link)]. Primers were ‘pig-tailed’ according to Brownstein et al. [57 (link)] and PCR products were directly labelled with fluorescent dye following the procedure by Blacket et al. [58 (link)]. Loci were separated into three multiplex 15 μL reactions. The reaction mix was prepared according to the microsatellite amplification procedure in the QIAGEN® Multiplex PCR Handbook and 0.5 ng of DNA. The cycling protocol included: the initial incubation step at 95°C for 15 minutes, 35 amplification cycles with 94°C for 30 s, 60°C for 90 s and 72°C for 60 s, followed by eight fluorescent labelling cycles with 94°C for 30 s, 53°C for 90 s and 72°C for 60 s, and final extension at 60°C for 30 minutes. Sizing of PCR products was done with Applied Biosystems 3730 DNA Analyser with 500 LIZ size standard. GeneMarkerV2.2.0 (Softgenetics, State College, PA) was used for allele scoring.