Rad52

Manufactured by Santa Cruz Biotechnology

Sourced in United States

RAD52 is a protein that plays a central role in DNA repair processes. It facilitates the recognition and binding of single-stranded DNA, and promotes the formation of complexes that are involved in the repair of double-strand breaks in DNA through homologous recombination.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Anti-Rad52 antibody (H-300; (2 citations) Anti-RAD52 (5 citations)

11 protocols using rad52

Western Blot Analysis of DNA Repair Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used: RPA32 (A300-244A, Bethyl Laboratories), RPA32 S4/S8 (A300-245A, Bethyl Laboratories), Lamin A/C (#4777, Cell Signalling), RAD52 (sc-365341, Santa Cruz Biotechnology), RAD51 (sc-8349, Santa Cruz Biotechnology), ERCC1 (NB500-704, Novus Biological), RAD52 (sc-365341, Santa Cruz Biotechnology), PARP1 (sc-8007, Santa Cruz Biotechnology). For total protein extraction, cells were lysed at 4°C in 50 mM HEPES pH7.5, 1% Triton X-100, 150 mM NaCl, 5 mM EGTA, supplemented with protease and phosphatase inhibitor cocktail (Roche Applied Science). Lysates were clarified by centrifugation at 10.000 × g for 20 min. Lysates containing equal amounts of proteins, estimated through the Bradford assay (Bio- Rad), were subjected to SDS-page. The chemiluminescent images were obtained using the ImageQuant LAS 500 (GE Healthcare). Band densitometry values inserted in all western blot figures indicate the levels of all phosho-proteins normalized to correspondent total protein and the last are normalized with the internal reference protein.

Barone D., Iannuzzi C.A., Forte I.M., Ragosta M.C., Cuomo M., Dell’Aquila M., Altieri A., Caporaso A., Camerlingo R., Rigano M.M., Monti D.M., Barone A., Imbimbo P., Frusciante L., Monda M., D’Angelo M., De Laurentiis M., Giordano A, & Alfano L. (2023). The hydrophilic extract from a new tomato genotype (named DHO) kills cancer cell lines through the modulation of the DNA damage response induced by Campthotecin treatment. Frontiers in Oncology, 13, 1117262.

+ Open protocol

+ Expand

Multiprotein DNA Repair Complex Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Actin (Santa Cruz, sc-1616); BLM (Bethyl, A300-110A); RMI1 (Bethyl, A300-631A); TOP3A (ProteinTech, 14525-1); ATR (Santa Cruz, sc-1887); Chk1 (Santa Cruz, sc-8408); PolD3 (Abnova, H00010714-M01); PolD1 (Bethyl, A304-005A); PolH (Bethyl, A301-231A); BRCA1 (EMD/Calbiochem, OP92); BRCA2 (EMD/Calbiochem, OP95); PALB2 (Bethyl, IHC-00251); Rad51 (Santa Cruz, sc-8349); Rad52 (Santa Cruz, sc-365341); Mre11 (Novus, NB100-142); Smc5 (Bethyl, A300-236A); Smc6 (Bethyl, A300-237A); FANCD2 (Novus, 100-182); RNas H1 (ProteinTech, 15606-1); mCherry (GeneTex,GTX128508), GAPDH (Cell Signaling, #2118). Myc (Santa Cruz, sc-40). Antibodies recognizing FANCM, FAAP24, MHF1, and MHF2 are generously provided by Dr. Xiaodong Wang. The antibody recognizing CtIP was generously provided by Richard Baer.

Pan X., Chen Y., Biju B., Ahmed N., Kong J., Goldenberg M., Huang J., Mohan N., Klosek S., Parsa K., Guh C.Y., Lu R., Pickett H.A., Chu H.P, & Zhang D. (2019). FANCM suppresses DNA replication stress at ALT telomeres by disrupting TERRA R-loops. Scientific Reports, 9, 19110.

+ Open protocol

+ Expand

BRCA2 Knockout and Gene Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human HeLa, HCC1395, 293T and U2OS cells were grown in Dulbecco’s modified Eagle’s medium (DMEM), while SH-SY5Y were grown in DMEM/F12 (1:1). Media was supplemented with 10% fetal calf serum. For BRCA2 gene knockout, the commercially available BRCA2 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-400700). Transfected cells were FACS-sorted into 96-well plates using a BD FACSAria II instrument. Resulting colonies were screened by western blot. Cell extracts, chromatin fractionation and western blot experiments were performed as previously described (29–31 (link)). Antibodies used for Western blot were: BRCA2 (Bethyl A303-434A), GAPDH (Santa Cruz Biotechnology sc-47724), RAD51 (Santa Cruz Biotechnology sc-8349), Vinculin (Santa Cruz Biotechnology sc-73614), RAD52 (Santa Cruz Biotechnology sc-365341). For gene knockdown, cells were transfected with Stealth siRNA (Life Tech) using Lipofectamine RNAiMAX reagent. For co-depletion experiments, control (non-targeting) siRNA was added to the targeting siRNA in the single knockdown samples to equalize total siRNA levels. The siRNA targeting sequences used were: E2F7 #1: GGACGATGCATTTACAGATTCTCTA; E2F7 #2: GACTATGGGTAACAGGGCATCTATA; E2F7 #3: AAACAAAGGTACGACGCCTCTATGA (used for E2F7 knockdown unless otherwise mentioned); BRCA2: GAGAGGCCTGTAAAGACCTTGAATT; RAD51: CCATACTGTGGAGGCTGTTGCCTAT; RAD52: GGCCAATGAGATGTTTGGTTACAAT.

Clements K.E., Thakar T., Nicolae C.M., Liang X., Wang H.G, & Moldovan G.L. (2018). Loss of E2F7 confers resistance to poly-ADP-ribose polymerase (PARP) inhibitors in BRCA2-deficient cells. Nucleic Acids Research, 46(17), 8898-8907.

+ Open protocol

+ Expand

Comprehensive DNA Damage Response Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nuclear and total cell lysates were obtained as described before (29 (link)) and analyzed by SDS-PAGE using primary antibodies against: TET2 (Cell Signaling #45010), DNMT3A (R&D Systems, MAB63151 and Cell Signaling #2160), ATM (Santa Cruz Biotech #sc-135663), 53BP1 (Abcam #ab-21083), CtIP (ThermoFisher Scientific #PA5-20963), SLFN11 (Abcam #ab121731), BRCA1 (EMD Millipore #OP92-100UG), BRCA2 (Abcam #ab75335), PALB2 (ThermoFisher Scientific #PA5-20796), RAD51 (Santa Cruz Biotech #sc-8349), RAD52 (Santa Cruz Biotech #sc-365341), RAD54 (Santa Cruz Biotech #sc-374598), DNA-PKcs (Bethyl #A300-518A), DNA ligase 4 (Santa Cruz Biotech #sc-271299), Ku80 (ThermoFisher Scientific #MA5-15873), Ku70 (Santa Cruz Biotech #sc-17789), PARP1 (Santa Cruz Biotech #sc-74470), PARP2 (Abgent #AP12265a), PARP3 (Abgent #AP6296b), DNA ligase 3 (Santa Cruz Biotech #sc-135883), Flag (Cell Signaling #2368), lamin B (Abcam #ab-16048-100), and β-actin (Santa Cruz Biotech #sc-47778) and the following secondary antibodies conjugated to HRP: goat anti-rabbit (EMD Millipore #12-348) and goat anti-mouse (EMD Millipore #AP181P).

Maifrede S., Le B.V., Nieborowska-Skorska M., Golovine K., Sullivan-Reed K., Dunuwille W.M., Nacson J., Hulse M., Keith K., Madzo J., Caruso L.B., Gazze Z., Lian Z., Padella A., Chitrala K.N., Bartholdy B.A., Matlawska-Wasowska K., Marcantonio D.D., Simonetti G., Greiner G., Sykes S.M., Valent P., Paietta E.M., Tallman M.S., Fernandez H.F., Litzow M.R., Minden M.D., Huang J., Martinelli G., Vassiliou G.S., Tempera I., Piwocka K., Johnson N., Challen G.A, & Skorski T. (2021). TET2 and DNMT3A Mutations Exert Divergent Effects on DNA Repair and Sensitivity of Leukemia Cells to PARP Inhibitors. Cancer research, 81(19), 5089-5101.

+ Open protocol

+ Expand

Western Blot Analysis of RAD52, PIF1, and H3

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells that were harvested from a confluent 6-well plate were lysed in RIPA buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP-40) supplemented with cOmplete protease inhibitors (Roche) and incubated on ice. Cells were sonicated for 10 s at 30% amplitude twice and the supernatant was retained after centrifugation. Proteins were quantified using a Pierce BCA protein assay kit. An SDS buffer containing 5% beta-mercaptoethanol (Bio-Rad) was added to the samples. Samples were heated at 95°C and electrophoresed on a 4–12% Tris-Glycine gel. The gel was transferred to a nitrocellulose membrane. The membrane was blocked with Superblock blocking buffer (Thermo Fisher) and probed for RAD52 (1:100, Santa Cruz), PIF1(1: 100, Santa Cruz), and histone H3 (1: 1000, Cell Signaling Technology). After secondary antibody incubation (1: 20,000, IRDYE 800 donkey anti-mouse IgG, IRDYE 680 goat anti-rabbit IgG), the membrane was imaged using Odyssey imager.

Showman S., Talbert P.B., Xu Y., Adeyemi R.O, & Henikoff S. (2024). Expansion of human centromeric arrays in cells undergoing break-induced replication. Cell reports, 43(3), 113851.

+ Open protocol

+ Expand

Western Blot Analysis of DNA Repair Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells from a confluent 6‐cm plate were lysed in NETN buffer (20 mM Tris–HCl, pH 8.0, 100 mM NaCl, 0.5 mM EDTA, 0.5% NP‐40). After adding 2X loading buffer (100 mM Tris–Cl, pH 6.8, 4% SDS, 0.2% bromophenol blue, 20% glycerol, 200 mM DTT), the samples were heated at 95°C for 5 min and separated on 6–15% SDS–PAGE. Antibodies used are: BRCA1 (sc‐6954, Santa Cruz Biotechnology), BRCA2 (sc‐293185, Santa Cruz Biotechnology), CTIP (A300‐487A, Bethyl), RAD51 (sc‐398587, Santa Cruz Biotechnology), RAD52 (sc‐365341, Santa Cruz Biotechnology), POLD3 (ab182564, Abcam), PCNA (NA03, Millipore), FLAG (F1804, Sigma‐Aldrich), HA (MMS‐101P, Covance), RFC1 (A300‐320A, Bethyl), MUS81 (sc‐376661, Santa Cruz Biotechnology), KU70 (sc‐17789, Santa Cruz Biotechnology), Peroxidase AffiniPure Goat Anti‐Mouse IgG(H + L; #115‐035‐146, Jackson Immuno Research Labs), and Peroxidase AffiniPure Goat Anti‐Rabbit IgG (H + L; #111‐035‐144, Jackson Immuno Research Labs). Antibodies against FANCM were kindly provided by Dr. Weidong Wang (NIH).

Li S., Wang H., Jehi S., Li J., Liu S., Wang Z., Truong L., Chiba T., Wang Z, & Wu X. (2021). PIF1 helicase promotes break‐induced replication in mammalian cells. The EMBO Journal, 40(8), e104509.

+ Open protocol

+ Expand

Protein Lysate Preparation and Western Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols

The nuclear and cytosolic protein lysates were prepared as described before (2 (link), 3 (link)), separated in 4% to 15% SDS-PAGE (Bio-Rad), and transferred onto a nitrocellulose membrane. Indicated proteins were detected by Western blotting analysis using primary antibodies recognizing Polθ (Invitrogen PA5–69577, MyBioSource MBS9612322), RAD54 (Santa Cruz Biotechnology, sc-374598), RAD52 (Santa Cruz Biotechnology, sc-365341), PARP1 (Santa Cruz Biotechnology, sc-74470), IDH1(R132H) (OriGene CF190113), histone H3 (Invitrogen, AHO1432), actin (Santa Cruz Biotechnology, sc-47778) and Flag (Cell Signaling Technology, #2368).

Pfeifer G.P., Steigerwald S.D., Hansen R.S., Gartler S.M, & Riggs A.D. (1990). Polymerase chain reaction-aided genomic sequencing of an X chromosome-linked CpG island: methylation patterns suggest clonal inheritance, CpG site autonomy, and an explanation of activity state stability.. Proceedings of the National Academy of Sciences of the United States of America, 87(21), 8252-8256.

+ Open protocol

+ Expand

Analysis of DNA Damage Response Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nuclear and total cell lysates were obtained as described before^{11 (link)} and analyzed by SDS-PAGE using primary antibodies against: ATM (Santa Cruz Biotechnology #sc-135663), CtIP (Abcam #ab-70163), 53BP1 (Abcam #ab-175933), SLFN11 (Santa Cruz Biotechnology #sc-515071), BRCA1 (ThermoFisher Scientific #MA1–23164), BRCA2 (Santa Cruz Biotechnology #sc-28235), PALB2 (Proteintech #14340–1-AP), RAD51 (Abcam #ab-88572), RAD52 (Santa Cruz Biotechnology #sc-365341), RAD54 (Santa Cruz Biotechnology #sc-374598), DNA-PKcs (Bethyl #A300–518A), Ku70 (Santa Cruz Biotechnology #sc-17789), Ku80 (ThermoFisher Scientific #MA5–15873), DNA ligase 4 (ThermoFisher Scientific #PA5–40826), PARP1 (Santa Cruz Biotechnology #sc-74470), PARP2 (Santa Cruz Biotechnology #sc-393310), PARP3 (Santa Cruz Biotechnology #sc-390771), DNA ligase 3 (Santa Cruz Biotechnology #sc-135883), Polθ (MyBioSource #MBS9612322), lamin B (Abcam #ab-16048–100), and β-actin (Santa Cruz Biotechnology #sc-47778) and the following secondary antibodies conjugated to HRP (horseradish peroxidase): goat anti-rabbit (EMD Millipore #12–348) and goat anti-mouse (EMD Millipore #AP181P). ZNF251 western analysis was performed with ZNF251 antibody (Proteintech cat# 25601–1-AP) and GAPDH antibody (Cell signaling technology cat#2118). For quantification of western analysis, ImageJ software was used to measure the density of the protein bands.

Li H., Chatla S., Liu X., Vekariya U., Kim D., Walt M., Lian Z., Morton G., Feng Z., Yang D., Liu H., Reed K., Childers W., Yu X., Madzo J., Chitrala K.N., Skorski T, & Huang J. (2023). Haploinsufficiency of ZNF251 causes DNA-PKcs-dependent resistance to PARP inhibitors in BRCA1-mutated cancer cells. Research Square.

+ Open protocol

+ Expand

Rad52 Regulation in DNA Damage Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein from E10, CL25M, Spon6 and Spon2 cells with shRNA targeting Rad52, constructs for overexpression of Rad52, scrambled vector control shRNA or empty pOPUR vector were extracted at 72–96 hours post transfection for transient transfections and in line with each experiment for stable stransfections. Cells were lysed with 100 μL of 1X RIPA lysis buffer containing proteinase inhibitor cocktails (Fisher Scientific, Pittsburg, PA), sonicated for 10 seconds, and spun at 13,000 RPM for 30 minutes at 4°C. Purified protein concentration was then calculated by the Bradford method, and boiled for 5 min. Normalized lysate was resolved by 4–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Invitrogen, Carlsbad, CA) and transferred to PVDF membranes. Commercial antibodies used included: Rad52 (Cell Signaling, Danvers, MA, USA, 2762), Rad52 (Santa Cruz, Dallas, TX, USA, SC20044), Anti-phospho-Histone H2A.X (Ser139) (EMD Millipore, Billerica, MA, USA), p21 (F-5) (Santa Cruz, Dallas, TX, USA, SC20044), and beta-Actin (Santa Cruz, Dallas, TX, USA, SC20044). Immunoblots were developed using Clarity Western ECL Substrate (BioRad, Hercules, CA, USA) and quantitated on a ChemiDoc XRS+ Imaging System (BioRad, Hercules, CA, USA).

Lieberman R., Xiong D., James M., Han Y., Amos C.I., Wang L, & You M. (2015). Functional characterization of RAD52 as a lung cancer susceptibility gene in the 12p13.33 locus. Molecular carcinogenesis, 55(5), 953-963.

+ Open protocol

+ Expand

Protein Extraction and Immunoblotting Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein extracts were isolated by boiling samples in 2X sample buffer [0.06 M tris-HCl (pH 6.8), 10% glycerol, 2% SDS, 5% 2-mercaptoethanol, 0.0025% bromophenol blue] before loading gels. Samples were collected according to equal cell numbers. Antibodies used were HA (Abcam, ab9110), H3 (Abcam, ab1791), Rad51 (Abcam, ab63798), Rad52 (Santa Cruz, sc-50445), Rad53 (49 (link)) Rfa1 and Rfa2 (50 (link)), Mre11 (LSBio, LS-C155765), α-tubulin (AbD Serotec, MCA78G), γ-tubulin (Abcam, ab27074), phospho-H2A S129 (Abcam, ab15083), and TAP tag antibody (Thermo Fisher Scientific, CAB1001). Secondary antibodies were anti-rabbit immunoglobulin G (IgG) (H + L), Alexa Fluor 594 (Invitrogen, A-11037), IRDye 680RD goat anti-rabbit IgG (H + L) (LICOR, 925–68071), IRDye 800CW goat anti-mouse IgG (H + L) (LICOR, 925–32210), anti-mouse horseradish peroxidase (HRP) (Promega, W4021), anti-rabbit HRP (Promega, W4011), and anti-rat HRP (Sigma, A5795).

Pal S., Postnikoff S.D., Chavez M, & Tyler J.K. (2018). Impaired cohesion and homologous recombination during replicative aging in budding yeast. Science Advances, 4(2), eaaq0236.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!