Qscript cdna synthesis

Total RNA was isolated using Trizol Reagent (Invitrogen, ThermoFisher Scientific) following the instructions of the manufacturer. After eliminating the genomic DNA using PerfeCTa DNase I (Quanta BioSciences, Beverly, MA, USA), 5 μg RNA were used for reverse transcription reaction in a final volume of 20 μL (qScript cDNA synthesis, Quanta BioSciences), generating complementary DNA (cDNA). cDNA was amplified using 1x PerfeCTa SYBR Green Supermix (Quanta BioSciences) and 250 nM primer (sequences are listed in Table 1) in a total volume of 10 μL. Real-time PCR was performed in triplicate using a CFX Connect Real-time System (Bio-Rad Laboratories) under the following conditions: 3 min at 95°C, followed by 41 cycles of 15 s at 95°C, 20 s at 60°C, and 30 s at 72°C. For quantification of mRNA levels, standard curves were taken into account to correct for differences in PCR efficiencies. Finally, expression levels were normalized to a composite factor based on the house-keeping genes Hprt and Rpl13a.

Following blood collection from the ARV-treated and untreated control HIV-infected hu-PBMC-NSG mice, the plasma was collected via the centrifugation of mouse blood for 15 min at 7000 rpm. Plasma viral RNA was isolated using a QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA, USA) per the manufacturer’s instructions. An RNA Quantification Standard ARP-3443 [13 ] was utilized for the determination of the plasma viral load. After isolation, 140 uL of the template was used in q-RT-PCR using a qScript cDNA Synthesis (Quanta Biosciences, Gaithersburg, MD, USA), followed by nested PCR, as previously described [11 (link)].

Brains were removed immediately after the second reminder and were placed in a perspex brain matrix and sliced into 1.0 mm segments. The CeA was punched using a 13G-14G microdissecting needle and was frozen at −70 °C until the RNA was extracted using the Total RNA Purification Micro Kit (Norgen biotek CORP, Canada) according to the manufacturer’s instructions. Extracted RNA (2 µg) was treated with DNase and reverse-transcribed to generate cDNA (qScript cDNA Synthesis, Quanta BioSciences).

The HIV RNA and DNA copy numbers were quantified by generating a standard curve. A 500 bp gBlock gene fragment encompassing the gag region [11 (link)] was synthesized (Integrated DNA Technologies, Coralville, IA, USA). The copy number was calculated using the DNA copy number web tool (ThermoFisher, Waltham, MA, USA) and converted to an RNA copy number by multiplying by 2. The fragment was suspended in sterile TE buffer at dilutions ranging from 10 to 10⁶ copies/μL, aliquoted and stored at −80 °C. The RNA extracted from the tissues was quantified using a nanodrop and approximately 500 ng total RNA was converted into cDNA using Qscript cDNA synthesis (Quanta Biosciences, Gaithersburg, MD, USA). The assay was performed with the Qultraplex 1-Step Toughmix Low (Quanta Biosciences, Gaithersburg, MD, USA) on the QuantStudios 5. The PCR conditions were 50 °C for 10 min and 95 °C for 3 min, followed by 40 cycles of 95 °C for 3 s and 55 °C for 30 s. The sequences of primers and probes used were as follows: Gag Probe FAM, /55-FAM/TTCGCAGTC/ZEM/AAT; Gag Forward Primer, GCAAGCAGGGAACTAGAAAGA; Gag Reverse Primer, CTGTCTGAAGGGATGGTTGTAG. The amount of tissue processed, total volume of nucleic acids extracted and dilutions performed at each step (cDNA synthesis, qPCR set up etc.) were considered in the calculations to finally equate to the copy number of viral nucleic acids per mg of tissue.