Geneart seamless cloning and assembly enzyme mix

All constructs were designed and cloned using a seamless cloning strategy. In brief, vectors were linearized using indicated primers (Table S1) in a PCR (Phusion Polymerase (ThermoFisher Scientific Cat. No. F530L)). Following PCR, template was digested using DpnI (NEB) at 37 °C for 30 min. PCR products were visualized by agarose gel electrophoresis (agarose 0,8%, TAE, 120 V, 40 min), cut-out and purified using a QIAGEN gel extraction kit (Cat. No. 28704). Inserts were amplified by PCR using the appropriate primers (Table S1). Vector and insert were assembled by seamless cloning using the ThermoFisher Scientific /Invitrogen GeneArt™ Seamless Cloning and Assembly Enzyme Mix (A14606) and transformed into chemically competent OneShot Top10-cells (Cat. No. C404006). Selection for successful cloning was done on LB-Ampicillin or LB-Kanamycin plates. Cells were grown overnight at 37 °C. Then, individual clones were picked and grown overnight in LB media (5 ml) containing the appropriate antibiotic (Ampicillin or Kanamycin). Plasmids were purified by a Miniprep kit (Cat. No.27104) and sequenced to verify successful cloning.

Target genes (SIRT3, NF-κB) were obtained from human FLS using PCR. The expression plasmids, pcDNA6-Flag (BamHI/XhoI) and pcDNA6-Myc (BamHI/XhoI), were obtained from Invitrogen (Groningen, The Netherlands). Transfection was performed using GeneArt® Seamless Cloning and Assembly Enzyme Mix (Invitrogen, #A14606) for 24 h according to the manufacturer's instructions. The transfection efficiency was tested using the Sanger sequencing (Sangon Biotech, Shanghai, China).

Full-length flagellin A−E genes from V. anguillarum (flaA−E) were obtained by PCR using primers listed in Table 1. PCR products were purified from a 1.5% agarose gels and cloned into the pET28 expression vector using GeneArt Seamless Cloning and Assembly Enzyme Mix (Invitrogen). Competent E. coli (DE3) cells were separately transformed with pET28-flaA−E constructs, and transformants were cultured in LB medium (50 μg/mL kanamycin) at 37°C, then in SOC medium (50 μg/mL kanamycin) at 37°C for another 2−3 h to OD₆₀₀ 0.5−0.6. IPTG was added to a final concentration of 0.5 mM to induce expression of flagellins, and bacteria were collected and resuspended in phosphate-buffered saline (PBS) with 1% Triton X-100.
Bacteria were lysed by sonication (200−300 W) and bacterial lysates were centrifuged at 12,000 rpm for 10 min at 4°C Supernatants and precipitates were separated and analysed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Recombinant proteins in soluble supernatants were purified from inclusion bodies under denaturing conditions using Ni-NTA Agarose (Qiagen). Protein concentration was determined using a BCA protein assay kit according to the manufacturer’s instructions (Beyotime).

For pPB‐mCherry vector construction, a PCR product encoding GCaMP5 sensor incorporating the CaMP3 mutation T302L R303P D380Y and no stop codon (Addgene plasmid #31788) was directionally ligated into pENTR/D‐TOPO vector (Invitrogen K243520) resulting in pEntry_GCaMP5G construct.
(For: caccATGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGAC, REV: TTACTTCGCTGTCATCATTTGTACAAACTCTTCGTAG) pEntry_GCaMP5G was linearized with PCR using standard Phusion^® Hot Start Flex 2X Master Mix (NEB Cat# M0536L) protocol (FOR: cgcgccgacccag, REV: ctcgagggatccggatcctcccttcgctgtcatcatttgtacaaac). PCR product was then subjected to DpnI digestion (NEB cat# R0176S) and gel purification with Zymoclean Gel DNA Recovery Kit (ZYMO cat#D4001). A sequence encoding mCherry and a5′ linker was PCR‐amplified (FOR: gaggatccggatccctcgagAccatggtgagcaagggc REV: aagaaagctgggtcggcgcgcttgtacagctcgtccatg). mCherry2‐C1 was a gift from Michael Davidson (Addgene plasmid # 54563).
GeneArt Seamless Cloning and Assembly Enzyme Mix (Invitrogen cat# A14606) was used to assemble a construct encoding for GCaMP5 sensor fused with a short linker to mCherry called pENTRY‐GCaMP5fusedmCherry. LR recombination between this entry clone and a custom gateway PiggyBack transposon vector with 1 μl LR Clonase II enzyme (Invitrogen: cat #11791020) resulted in the final construct of pPB_CAG_GCaMP5fusedmCherry_blast.

Plasmids for expression of MinE mutant proteins were generated with our previously described His-MinE expression vector [11 (link)]. All mutants with amino acid substitutions were made by site-directed mutagenesis using the GeneArt^® Site–Directed Mutagenesis System (Invitrogen, Carlsbad, CA, USA). The MinE truncation mutant lacking amino acids 2–12 was generated with the GeneArt^® Seamless Cloning and Assembly Enzyme Mix (Invitrogen, Carlsbad, CA, USA). All plasmids were sequenced to verify the mutations. Mutagenic primers used in this study are shown in S1 Table.