Rna pcr kit

After transfection, total RNA was extracted from HeLa cells using the RNAprep Pure Cell Kit (TIANGEN, China) and then reverse-transcribed into cDNA using the RNA PCR Kit (TOYOBO, Japan) according to the manufacturer's instructions. Real-time PCR was conducted using a ViiA7 DX Instrument (Life Technologies, USA). The reactions were completed in a total volume of 10 µl containing 5 µl of SYBR Green Real-Time PCR Master Mix (TOYOBO, Japan), 2 µl of ddH₂O, 1 µl of cDNA, and 1 µl of each primer. PCR amplification was performed using the following conditions: 10 s at 95°C and 45 cycles of 15 s at 95°C and 60 s at 60°C. The relative mRNA expression level was analyzed using the 2^−ΔΔCT calculation method. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression level was used as an endogenous control. The forward primers and reverse primers were obtained from Sangon Biotech (Shanghai, China), and their respective sequences were as follows: ARHGEF10L: 5′AGTGCCAGGTGGTGTTCTTC3′ and 5′AAGAGGTCCCCGATCTTCTC3'; GAPDH: 5′CAGAACATCATCCCTGCCTCTAC3′ and 5′TTGAAGTCAGAGGAG ACCACCTG3'; HSPA6: 5′ ACTTTCACCACCTACTCGGA 3′ and 5′ CCCTCTCA CCCTCATACAC3'. All experiments were repeated at least three times.

Total RNA of tissues or cells was extracted using Trizol reagent (Life Technologies, USA). The extracted RNA was reverse-transcribed into first-strand cDNA in a final volume of 10 µL using an RNA PCR Kit (Toyobo, Japan). The reverse-transcribed first-strand cDNA was used as the template for real-time PCR with the forward primer and the reverse primer. The conditions of real-time PCR were as follows: 10 s at 95 °C; 45 cycles of 5 s at 60 °C and 10 s at 72 °C; and 30 s at 65 °C. This experiment was performed in triplicate. Real-time PCR was performed using a 10 µL total volume that contained 1 µL of cDNA, 2 µL of ddH₂O, 5 µL of SYBR Green Real-time PCR Master Mix (Toyobo, Japan), 1 µL of forward primer and 1 µL of reverse primer. GAPDH was used for quantity and quality control using the forward primer of human GAPDH-QF and the reverse primer of human GAPDH-QR. The primer sequences in detail used in this study are shown in Additional file 1: Table S1. Data were analyzed using the formula R = 2^{−[ΔCt sample − ΔCt control]}, where R is the relative expression level, ΔCt sample is the difference between the Ct of the gene and the average GAPDH in the experiment sample, and ΔCt control is the difference between the Ct of the gene and the average GAPDH in the control sample.