Total RNA was extracted using TRIzol (Ambion, 262301, USA) and reverse‐transcribed from RNA to cDNA using the corresponding kit (RR036A, TAKARA, Japan). The sequences of the primers used to amplify the cDNA are listed in Table S2 . Reverse transcriptase‐quantitative polymerase chain reaction used the SYBR Green kit (RR420A, TAKARA). The thermocycling procedure was as follows: pre‐denaturation at 95 °C for 30 seconds, followed by 40 cycles of 95 °C for 5 seconds, and 60 °C for 30 seconds using a real‐time PCR cycler (Roche Light Cycler 480 II, Basel, Switzerland).
Rr036a
Manufactured by Takara Bio
Sourced in Japan, China
The RR036A is a laboratory instrument designed for efficient RNA extraction. It utilizes a magnetic bead-based protocol to isolate high-quality RNA from a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (17 mentions)
Rr820a, by Takara Bio (8 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
Sybr premix ex taq 2, by Takara Bio (6 mentions)
Trizol reagent, by Takara Bio (5 mentions)
Rr420a, by Takara Bio (5 mentions)
Lightcycler 480 system, by Roche (4 mentions)
Lightcycler 480 2, by Roche (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr kit, by Takara Bio (3 mentions)
Rnaiso, by Takara Bio (3 mentions)
7500 fast system, by Thermo Fisher Scientific (2 mentions)
Rnaiso plus reagent, by Takara Bio (2 mentions)
Cfx connect real time system, by Bio-Rad (2 mentions)
Trizol reagent, by Qiagen (2 mentions)
Lightcycler 480 real time pcr system, by Roche (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Trizol, by Takara Bio (2 mentions)
Sybr green kit, by Takara Bio (1 mentions)
Sybr green mix, by Yeasen (1 mentions)
67 protocols using rr036a
1
Quantifying Gene Expression via RT-qPCR
2
Aortic Tissue RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from aortic tissue using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and RNA was isolated from sorting macrophages using the RNeasy Plus Micro Kit (74034, QIAGEN, Hilden, Germany), according to the instructions of the manufacturer. RNA samples (1 μg) were subsequently reverse-transcribed into cDNA with a reverse transcription reagent kit (RR036A, Takara Bio Inc., Kusatsu, Japan), and the resulting cDNA was amplified by RT-PCR using the SYBR Green Mix (11201ES08; Yeasen, Shanghai, China). Each sample was analyzed in triplicate and normalized to a reference RNA. Relative expression levels were quantitated using the ΔΔCt method.
3
Rat Tissue RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from rat tissue using TRIzol reagent (T9424, Sigma-Aldrich, USA) according to the manufacturer’s instructions. The gene expression levels were analyzed by real-time quantitative PCR (qRT-PCR). First-strand cDNA was synthesized from 2 μg total RNA in 10 μL reaction mixture using a cDNA synthesis kit (RR036A, TAKARA, Japan) according to the manufacturer’s instructions. Prepared cDNA (2 μL) was used as a template for qRT-PCR. The qRT-PCR was performed using 2×Real Star Fast SYBR qPCR Mix (SYBR Green with ROX;Enzynomics, Genster, China) according to the manufacturer’s instructions. Relative gene expression levels were determined using rat β-actin as an internal standard gene. The gene-specific primers used for real-time RT-PCR analysis are listed in Supplement Table 1 . The primers were obtained from Shanghai Bioengineering Co., LTD.
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was harvested from ATDC5 cells using TRIzol reagent (TAKARA, Japan). Reverse transcription of total RNA to cDNA was performed using a commercial kit (RR036A, TAKARA, Japan). Selected genes (HDAC 3, Col1a1, VEGFA, Runx2, Aggrecan, OPG, Sox9, and Col10a1) were subjected to real-time semi-quantitative PCR (qPCR) analysis (RR820A, TAKARA) with SYBR® Premix Ex Taq™ II (RR820A, TAKARA, Japan). The analysis was performed on an ABI 7500-Fast Real-Time PCR System (Applied BioSystems, Foster City, USA). Reaction settings were as follows: first 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 34 s. The real-time PCR primers were synthesised as shown in Supplementary Materials Table S1
5
Quantifying Rat Mitochondrial Protein Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using TRIzol reagent (15596018, Invitrogen) and total RNA density was detected using Nanodrop (Thermo). Then RT-PCR were conducted using a kit (RR036A, Takara). Real-time quantitative PCR (RT-qPCR) was carried out using another kit (RR420A, Takara). And the primer pairs used were listed:
TCAGTCAGAGGCTAAGGTGGTGTC and TGGAGAGTGTGCCAGCTAGGTC for rat MIC60;
ACGGCAAGTTCAACGGCACAG and CGACATACTCAGCACCAGCATCAC for rat GAPDH;
AGGTGTGGTGGACAGTGAGGAC and GCATTCGGCTGGCGTAGTCTG for rat TRAP1.
6
Comprehensive Gene Expression Analysis of Metabolic Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TriZol reagent (15596026, Invitrogen) according to the manufacturer's instructions. The purified total RNA was used as a template to generate first-strand cDNA synthesis kit (RR036A, Takara). TaqMan probe/primers that were pre-optimized and validated by the manufacturer (only probe sequence provided by Thermo Fisher Scientific, USA, Supplementary Table 2 ) were used for quantitative real-time PCR (StepOnePlus Real-Time PCR System, Applied Biosystem). Markers of appetite regulation, including Npy, Npy Y1 receptor (Npy1r), Pomc, and single minded gene (Sim1), were measured in the hypothalamus. Marker involved in substrate metabolism carnitine palmitoyl-transferase (Cpt1α) and Tnfα were measured in the Rp fat. Thermogenesis markers Uncoupling protein (Ucp1 and Ucp3) were measured in BAT. Expression of muscle metabolic markers PPARγ coactivator (Pgc1α and Pgc1β), Myog and MyoD were measured in the soleus muscle.
7
Quantitative Gene Expression Analysis of Liver Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from liver tissues using TRIzol reagent (Takara, Dalian, China) and reverse-transcribed into cDNA using a cDNA synthesis kit (RR036A, Takara, Dalian, China).
Specific gene expression was detected by qPCR using SYBR Green (Qiagen, Hilden, Germany) with an Applied Biosystems QuantStudio 5 instrument. Relative gene expression was calculated using the 2−ΔΔCt method. The primers used in this study are shown inTable 1 .
Specific gene expression was detected by qPCR using SYBR Green (Qiagen, Hilden, Germany) with an Applied Biosystems QuantStudio 5 instrument. Relative gene expression was calculated using the 2−ΔΔCt method. The primers used in this study are shown in
8
Quantitative RT-PCR for ER Stress Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted and purified from PASMCs, followed by reverse transcription to cDNA (TaKaRa RR036A) and cDNA amplification (TaKaRa, RR420A). Primer sequences are as follows: Xbp1s: forward: 5′-CTG AGT CCG CAG CAG GTG-3′, reverse: 5′-GAC CTC TGG GAG TTC CTC CA-3′. Ddit3: forward: 5′-GTC ACA AGC ACC TCC CAA AGC C-3′, reverse: 5′-CGC ACT GAC CAC TCT GTT TCC G-3′. Hsp90b1: forward: 5′-GGC CCT CAA GGA CAA GAT CG-3′, reverse: 5′-CTT GCC CGT CTG GTA TGC TT-3′. Hspa5: forward: 5′-GTG CCC ACC AAG AAG TCT CA-3′, reverse: 5′-AGG GGT CGT TCA CCT TCG TA-3′. Ern1: forward: 5′-GCG CAG GTG CAA TGA CAT AC-3′, reverse: 5′-CCT GCA GGA CTG GAT CTT CTT-3′. ATF2: forward: 5′-GTT CCT GTA CCA GGC CCA TT-3′, reverse: 5′-GAC TGG CCG AAC AAG TGG GA-3′. ATF3: forward: 5′-ATG TCA GTC ACC AAG TCT GAG G-3′, reverse: 5′-TCT CCA GTT TCT CTG ACT CCT TCT G-3′. ATF4: forward: 5′-CATG GGT TCT CCA GCG ACA A-3′, reverse: 5′-CCG GAA AAG GCA TCC TCC TTG-3′. ATF6: forward: 5′-ACG ACA GAG TCT CTC AGG TTG-3′, reverse: 5′-GCT GAG AAT TCG AGC CCT GT-3′. Creb1: forward: 5′-CAA ACA TAC CAG ATT CGC ACA G-3′, reverse: 5′-TCT CTT TCG TGC TGC TTC TT-3′. Actin: forward: 5′-CGT AAA GAC CTC TAT GCC AAC A-3′, reverse: 5′-CGG ACT CAT CGT ACT CCT GCT-3′. The relative quantifications were performed using the 2−Δ(ΔCt) method.
9
Zymosan-A Induced Intestinal Organoid Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zymosan-A was purchased from Sigma Aldrich Corp (St. Louis, MO, USA), WR2721 and normal saline (NS) was obtained from ChangHai Hospital (Shanghai, China). The PCR kit (RR036A and RR420A) was purchased from TAKARA (Japan). PBS, RPMI 1640, DMEM, and fetal bovine serum (FBS) were supplied by Gibco (New York, USA). IntestiCult™ Organoid Growth Medium was obtained from STEM CELL (Canada). The antibodies for Western blot (GAPDH, YAP1, WNT5A, WNT3A, MYD88, TLR2, OLFM4, ASCL2, CYCLIND1, AXIN2) were purchased from Cell Signaling Technology (Massachusetts, USA). The antibody for western blot (ASCL2) was purchased from Biorbyt (Cambridge, United Kingdom). In Situ Cell Death Detection Kit was obtained from Roche (Basel, Switzerland). Small molecule Foscenvivint (ICG-001) was purchased from Selleck. The primes were obtained from Shenggong Biotech (Shanghai, China).
| LGR5- Forward Primer | CCTACTCGAAGACTTACCCAGT |
| LGR5- Reverse Primer | GCATTGGGGTGAATGATAGCA |
| ASCL2- Forward Primer | AAGCACACCTTGACTGGTACG |
| ASCL2- Reverse Primer | AAGTGGACGTTTGCACCTTCA |
10
Quantifying Gene Expression in Jejunum Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in jejunum tissue was extracted using TRIzol reagent (CW0580; CoWin Biosciences Co., Ltd., Beijing, China), and cDNA was generated using a reverse transcription kit (RR036A; Takara, Kusatsu, Japan). The SYBR®Premix Ex Taq™ kit (Takara, Dalian, China) was used for quantitative PCR analysis. The expression levels of the target gene were evaluated using the comparative 2−ΔΔCtmethod. The PCR primer sequences are shown in Table 2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!