To validate the miRNA arrays results, the Bulge-Loop miRNA qPCR Primer Set (RiboBio, Guangzhou, China) was used to determine the expression levels of dysregulated miRNAs by Quantitative reverse transcription polymerase chain reactions (qRT-PCRs) with iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) on an ABI-7900 Real-Time PCR Detection System (7900HT, Applied Biosystems, Foster city, CA, USA). U6 was used as an endogenous control. The expression levels of RhoBTB1, RhoBTB2 and RhoBTB3 were analyzed by quantitative PCRs with SYBR Green (TaKaRa) on an ABI-7900 Real-Time PCR Detection System (7900HT, Applied Biosystems). 18S was used as an inner control for normalization. The primer sequences used were as follows (5′–3′): RhoBTB1 (forward GAAAGCCTTCCACGTCAGGA and reverse GTGCAACCAAGTGTGTCAGG), RhoBTB2 (forward TCTTCGAGCCTCCATGACATT and reverse ACCTCCTAGGGTCCCAGTTC) and RhoBTB3 (forward GTAGCTTGTTGCTGAACGCC and reverse GCCGCAATGATGACTGGAAC). The 18S (forward AGTCCCTGCCCTTTGTACACA and reverse CGATCCGAGGGCCTCACTA) was used for normalization. The relative expression level was calculated using the 2−ΔΔCt method.
Abi 7900 real time pcr detection system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan
The ABI-7900 Real-Time PCR Detection System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is capable of detecting and quantifying nucleic acid sequences in real-time, allowing for accurate and sensitive analysis of genetic samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Iscript cdna synthesis kit, by Bio-Rad (4 mentions)
Bulge loop mirna qpcr primer set, by RiboBio (3 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Revertra ace qpcr rt kit, by Toyobo (2 mentions)
Paris kit, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr kit, by Toyobo (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Sybr green qpcr master mix kit, by Bio-Rad (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Rnase free dnase 1, by Promega (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Syber green reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit with cdna eraser, by Takara Bio (1 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (1 mentions)
18 protocols using abi 7900 real time pcr detection system
1
Validating miRNA Expression Profiles by qRT-PCR
2
Cardiac Fibroblast and Heart RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cardiac fibroblasts and heart samples by using miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. Total RNAs (400 ng) were reverse transcribed using Bio-Rad iScriptTM cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) to obtain cDNAs. The expression levels of TGF-β, α-SMA, Col1a1, and Col3a1 were analyzed by using Bio-Rad SYBR qPCR (Bio-Rad, Hercules, CA, USA) on ABI-7900 Real-Time PCR Detection System (7900HT, Applied Biosystems, CA, USA). 18S RNA was used as an internal control for gene expressions. Primer sequences used in the study are listed in Supplemental Table 1 . For quantitative miRNA analysis, the Bulge-LoopTM miRNA qPCR Primer Set (RiboBio) was used to determine the expression levels of miRNAs with Takara SYBR Premix Ex TaqTM (Tli RNaseH Plus) on ABI-7900 Real-Time PCR Detection System (Applied Biosystems). U6 was used as an internal control for miRNA template normalization.
3
Quantifying HOXC8 and miR-4256 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was extracted using TRIzol reagent (Invitrogen), and total RNA was reversely transcribed into complementary DNA (cDNA) by using the PrimeScript RT Reagent Kit (Takara). qPCR was performed using SYBR Premix Ex Taq™ (TakaRa) on an ABI7900 real-time PCR detection system (Applied Biosystems, Foster City, USA) following the manufacturer’s instructions. GAPDH and U6 were respectively used as an internal control for HOXC8 and miR-4256 expression. The relative levels of genes were determined using the 2−ΔΔCt method.
4
Quantifying Cardiac mRNA Levels via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect relative mRNA expression levels in cardiac tissues and NRVMs, the TRIzol reagent was used to extract total RNA, according to the manufacturer's protocol (Takara, Japan). Reverse transcription was performed using 500 ng total RNA to synthesise the complementary DNA (cDNA) using the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Using the appropriate proportions of the SYBR Green qPCR Master Mix kit (Bio-Rad, Hercules, CA, USA), cDNA, and deionised water, the ABI-7900 Real-Time PCR Detection System (7900HT, Applied Biosystems, CA, USA) was used to quantify mRNA expression, which was normalised against the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the comparative quantification method (2−ΔΔCT). All primers utilised for amplification are listed in Supplementary Table 1 .
5
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, USA). The nuclear and cytoplasmic fractions were extracted using a PARIS kit (Thermo Scientific, USA) according to the manufacturer’s instructions. cDNA was synthesized by reverse transcription using a ReverTra Ace qPCR RT Kit (Toyobo, Japan). A SYBR Green PCR Kit (Toyobo, Japan) and an ABI 7900 real-time PCR Detection System (Applied Biosystems, USA) were used for RT‒qPCR analysis. All RT-qPCR assays were performed in triplicate. The primer sequences used are listed in Additional file 2 : Table S2.
6
Quantitative Analysis of Exosomal and Cellular miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted by Trizol and treated with RNase-free DNase I (1/20 µL, Promega Corp, Madison, WI). Reverse transcription of cDNAs was performed using Reverse Transcription Kit (Takara, Dalian, China). Polymerase chain reaction analysis (PCR) analysis was performed with SYBR green PCR Master Mix (Applied Biosystems, Foster, CA, USA) on ABI‐7900 Real‐Time PCR Detection System (7900HT; Applied Biosystems). The exosomal level of miR-214-3p was normalized to that of cel-miR-39 (C39). The cellular miR-214-3p expression was normalized to U6. The cellular expression of PTEN mRNA was normalized to that of glyceraldehyde3-phosphate dehydrogenase (GAPDH). The related gene expression was normalized to that of GAPDH. The primer sequences are listed in Additional file: Table S1 .
7
Quantifying mRNA Levels in Prostate Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from DU145 and PC-3 cells using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and reverse transcribed into cDNA using a PrimeScript RT reagent kit with cDNA Eraser (TaKaRa, Dalian, China). Reverse transcription (RT) products were used as templates for subsequent qPCR.
The following primers were used in this study:
The mRNA levels of the target genes were analyzed by the ABI7900 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) with Syber Green reagent (Thermo Fisher Scientific). GAPDH was used as an internal control for normalization. The specificity of the fluorescence signal was confirmed by both melting curve analysis and agarose gel electrophoresis. The mRNA levels of target genes were determined by the 2−ΔΔCt method.
The following primers were used in this study:
The mRNA levels of the target genes were analyzed by the ABI7900 Real-Time PCR Detection System (Applied Biosystems, Foster City, CA, USA) with Syber Green reagent (Thermo Fisher Scientific). GAPDH was used as an internal control for normalization. The specificity of the fluorescence signal was confirmed by both melting curve analysis and agarose gel electrophoresis. The mRNA levels of target genes were determined by the 2−ΔΔCt method.
8
Quantitative RT-PCR of Ulk1 and Ulk2
9
Comprehensive RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) and then reverse transcribed into cDNA with iScript cDNA synthesis kit (Bio-Rad Laboratories, CA, USA). For quantitative miRNA analysis, the Bulge-LoopTM miRNA qPCR Primer Set (RiboBio) was used to determine the expression levels of miRNAs with Takara SYBR Premix Ex TaqTM (TliRNaseH Plus) in ABI-7900 Real-Time PCR Detection System (7900HT, Applied Biosystems, CA, USA). U6 was used as an internal control. For mRNA analysis, cDNA was synthesized using Bio-Rad iScriptTM cDNA Synthesis Kit (Bio-Rad) and was subjected to 40 cycles of quantitative PCR with Takara SYBR Premix Ex TaqTM (Tli RNaseH Plus, Japan) in ABI-7900 Real-Time PCR Detection System. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. Primer sequences (forward and reverse) used in the present study are as follows: ANP, AGCCGTTCGAGAACTTGTCTT and CAGGTTATTGCCACTTAGGTTCA; BNP, GAGGTCACTCCTATCCTCTGG and GCCATTTCCTCCGACTTTTCTC; α-SMA, GTCCCAGACATCAGGGAGTAA and TCGGATACTTCAGCGTCAGGA; Collagen I, GCTCCTCTTAGGGGCCACT and CCACGTCTCACCATTGGGG; Collagen III, CTGTAACATGGAAACTGGGGAAA and CCATAGCTGAACTGAAAACCACC; GAPDH, TGGATTTGGACGCATTGGTC and TTTGCACTGGTACGTGTTGAT. The relative expression level was calculated using the 2-ΔΔCt method.
10
Quantitative Real-time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed using procedures described previously5 (link). Total RNA was obtained from pancreas tissues or cultured cells using the Trizol Reagent (Invitrogen) and an ABI7900 real-time PCR detection system (Applied Biosystems, CA, USA). The expression values were normalized against a housekeeping gene (GAPDH), and fold changes were calculated relative to the control group using the 2−∆∆Ct method. Each sample was analyzed in duplicate. The primers are listed in the previously published protocol5 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!