Total RNA was isolated from cell cultures with TRIzol reagent (Invitrogen), then cleaned using RNeasy Plus Mini Kit (Qiagen cat No. 74134) after DNase treatment (Ambion). Five hundred nanograms of DNase-treated total RNA was reverse transcribed using Taqman reverse transcription reagent (Roche). The complementary DNA was diluted 100 times, and the equivalent to 2 ng of total RNA was applied to each real-time PCR with a total volume of 10 µL. RNA expression was quantified by using SYBR green real-time PCR analysis on an ABI 7900HT real-time PCR system (Applied Biosystems). Primer sequences (5′–3′) are Cx43 (GJA1) forward: cttttaagcaaaagagtggtgcc, Cx43 (GJA1) reverse: ggcttgaaccttgtcaaggag, Cx45 (GJC1) forward: tgttccagatcatcctggtg, and Cx45 (GJC1) reverse: cttgtctgcttcaccgtgc.
Taqman reverse transcription reagent
Manufactured by Roche
Sourced in United States, Switzerland
TaqMan Reverse Transcription Reagents are a set of reagents used for the reverse transcription of RNA to complementary DNA (cDNA). The kit includes a reverse transcriptase enzyme, buffer, and other necessary components to perform this reaction.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Taqman universal pcr master mix, by Roche (3 mentions)
Rneasy kit, by Qiagen (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Solarbio (2 mentions)
Isogen, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Abi 7900ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
Taqman gene expression assay, by Roche (1 mentions)
Lightcycler 2, by Roche (1 mentions)
Sensiscript rt kit, by Qiagen (1 mentions)
Sensiscript reverse transcriptase kit, by Qiagen (1 mentions)
Qiaamp viral rna mini kit, by Qiagen (1 mentions)
Oligo dt 15 primer, by Promega (1 mentions)
Protector rnase inhibitor, by Roche (1 mentions)
Control sirna, by Thermo Fisher Scientific (1 mentions)
17 protocols using taqman reverse transcription reagent
1
Quantification of Connexin mRNA Expression
2
RNA Isolation and RT-qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 100 μL of the tissue homogenate or cells from each group were placed in a reaction tube to isolate the total RNA content with 1 mL of the TRIzol reagent (15596-018, Beijing solarbio science & technology co. ltd., Beijing, China). Subsequently, 2 μg RNA was obtained for cDNA synthesis using the TaqMan reverse transcription reagent (Roche, Basel, Switzerland) at 42 °C for 50 min, and then PCR (50 μL reaction system) was conducted to amplify the target gene fragment. The primers used in the PCR were synthesized by Sigma-Aldrich (Table 7 ). The amplification conditions were as follows: pre-denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 45 s, annealing at 55 °C for 45 s and extension at 72 °C for 45 s, and extension at 72 °C for another 10 min. The relative expression levels of ADRB3 and HDAC3 or miR-18a were normalized to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 and calculated on the basis of the 2−ΔΔCt method for CT value estimation [48 (link)].
Primer sequences for RT-qPCR
| Gene | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| miR-18a | TAAGGTGCATCTAGTGCAGATAG | GCGAGCACAGAATTAATACGAC |
| ADRB3 | CGCCTTCAACCCGGTCATCTACTG | GGTGGACTCTGCCTGGCTTCAAC |
| HDAC3 | GACATGTGCCGCTTCCATTC | CTGGCTGGAAAAGGTGCTTG |
| U6 | GCATGACGTCTGCTTTGGA | CCACAATCATTCTGCCATCA |
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
3
Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using Isogen (Life Technology, Tokyo, Japan) according to the manufacturer’s instructions. For cDNA synthesis, Taqman reverse transcription reagents (Roche Diagnostics, Indianapolis, IN, USA) were used as described in the manufacturer’s manual. Variations in the expression of the genes and control 18S ribosomal RNA were analyzed using a Step One Plus real-time PCR system (Life Technologies, Tokyo, Japan) with SYBR green. For the RT-PCR analysis, primers were chosen for their dissociation curves, lack of nonspecific amplification, and relatively good amplification efficiency. The base sequences for the utilized primers are as follows: beta-actin Forward 5′- CGGGACCTGACTGACTACCT -3′, Reverse 5′- CTCCTTAATGTCACGCACGA -3′; alpha-tubulin Forward 5′- CATTGAAAAGTTGTGGTCTGATCA -3′, Reverse 5′- GCTTGGGTCTGTAACAAAGCAT -3′; 18S rRNA Forward 5′- ACGGACAGGATTGACAGATTG -3′, Reverse 5′- ATCGCTCCACCAACTAAGAAC -3′.
4
Circadian Clock Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from six fish each time using Isogen (Life Technology) according to the manufacturer’s instructions. For cDNA synthesis, Taqman reverse transcription reagents (Roche Diagnostics, Indianapolis, IN, USA) were used as described in the manufacturer’s manual. Variations in the expression of the clock genes per1, bmal1, and the control 18S rRNA gene were analyzed using a Step One Plus real-time PCR system (Life Technologies) with SYBR green. For the RT-PCR analysis, primers were chosen for their dissociation curves, lack of non-specific amplification, and relatively good amplification efficiency. The base sequences for the utilized primers are as follows:
per1 Forward 5′-TACCACCAGTGGAGTGTGGA-3′, Reverse 5′-AGGTGTCCGTGTTTTTCAGG-3′; bmal1 Forward 5′-CCATGTCCCGCAAGTTGGAC-3′, Reverse 5′-GCAATGTCCTTGGGATGCAG-3′; 18S rRNA Forward 5′- AAGCAGGCCCGGTCGCCTGAATACC-3′, Reverse 5′- AATCGCTCCACCAACTAAGAACGGCCATGC-3′.
The data shown is a representative triplicate experiment.
per1 Forward 5′-TACCACCAGTGGAGTGTGGA-3′, Reverse 5′-AGGTGTCCGTGTTTTTCAGG-3′; bmal1 Forward 5′-CCATGTCCCGCAAGTTGGAC-3′, Reverse 5′-GCAATGTCCTTGGGATGCAG-3′; 18S rRNA Forward 5′- AAGCAGGCCCGGTCGCCTGAATACC-3′, Reverse 5′- AATCGCTCCACCAACTAAGAACGGCCATGC-3′.
The data shown is a representative triplicate experiment.
5
Cytauxzoon felis DNA and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cytauxzoon felis genomic DNA was extracted from leukoreduced blood (Purecell NEO Neonatal High Efficiency Leukocyte Reduction Filter for Red Cell Aliquots, PALL Corp., Port Washington, NY) using a commercially available kit (QIAamp DNA Blood Mini Kit Qiagen, Valencia, CA). RNA was extracted from liver tissue of a cat infected with C. felis using a commercially available kit (ZR Tissue and Insect RNA Kit, Zymo Research, Irvine, CA). Using this RNA as template, cDNA was synthesized with Taqman Reverse Transcription Reagents following the two step RT-PCR protocol according to manufacturer’s instructions (Roche, Mannheim, Germany).
6
Quantifying Gene Expression in EndoC-βH1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from EndoC-βH1 cells using the Ultraspec RNA reagent (Biotecx, Houston, TX, USA). TaqMan Reverse Transcription Reagents and TaqMan Gene Expression Assays were used for production of cDNA and detection by real-time RT-PCR (Lightcycler 2.0, Roche), respectively. The genes of interest were normalized to an internal control (GAPDH). The primer list and specifications are given in Supplementary Table 1 (available online).
Gene expression of the target genes were quantified by relative quantification using the comparative CT method. Data represent normalized target gene expression expressed as fold change (2(-ΔΔCt)*100, where ΔΔCt = ΔCt (target genetreat‐GAPDHtreat) ‐ Δct (target genecontrol‐GAPDHcontrol)).
Gene expression of the target genes were quantified by relative quantification using the comparative CT method. Data represent normalized target gene expression expressed as fold change (2(-ΔΔCt)*100, where ΔΔCt = ΔCt (target genetreat‐GAPDHtreat) ‐ Δct (target genecontrol‐GAPDHcontrol)).
7
Viral Nucleic Acid Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral DNA/RNA protected from digestion within viral capsids were extracted using QIAamp Viral RNA mini kit (QIAGEN), according to manufacturer’s recommendations. A second DNase/RNase step was performed on the extracted viral RNA for elimination of genomic DNA, using DNase I recombinant, RNase free (10U/μl) (Roche) and Protector RNase inhibitor (40 U/μl) (Roche). After digestion of the DNA, the viral RNA was transcribed with Sensiscript Reverse Transcriptase kit (QIAGEN; Sensiscript RT kit) to generate cDNA, according to manufacturer’s instructions with minor modifications. Briefly, for a more sensitive detection in the subsequent PCR, a mixture of oligo-dt primers (Oligo (dT)15 primer, Promega) and random primers (Random hexamers, TaqMan Reverse Transcription Reagents, Roche, Applied Biosystems) were used and a RNA denaturation step (95° for 3 minutes) was added.
8
FAK and β1-integrin Knockdown Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AGS were transfected with 50 nM siRNA using Lipofectamine RNAiMAX Reagent (Invitrogen) according to manufacturer’s instructions. siRNAs against FAK, β1-integrin, and control siRNA (with equal GC content) were purchased from Invitrogen. Cells were harvested 24 h post-transfection with FAK, β1-integrin, or control siRNA in RLT buffer (Qiagen RNeasy Mini Kit) + 1% β-mercaptoethanol. RNA isolation was performed as described in the Qiagen RNeasy Mini Kit protocol. Using the TaqMan Reverse Transcription Reagents (Roche, Germany) with random primers according to the kit protocol, we transcribed 1 µg mRNA into cDNA. Oligonucleotide primers specific for FAK, β1-integrin, and the housekeeping gene 18S rRNA were applied for real-time reverse transcription (RT)-PCR (ABI PRISM 7000, Applied Biosystems). For the amplification step, the FastStart Universal SYBR Green Master (ROX) kit (Roche) was used according to manufacturer’s instructions (data not shown). Immunoblotting was performed to verify the FAK- and β1-integrin-knockdown rate on protein level.
9
Quantitative Real-Time PCR of RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from sorted cells with a Qiagen RNeasy Micro Kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany) and then reverse-transcribed into cDNA by using TaqMan Reverse Transcription Reagents (Roche Diagnostics, Mannheim, Germany). Real time PCR was performed using SYBR Premix Ex Taq (Takara, Kyoto, Japan) in a final volume of 10 μl. Samples were amplified, and the relative gene expression levels were calculated using standard curves generated by serial dilutions of the cDNA. Specific primer sequences used for PCR are listed in S1 and S2 Tables.
10
Quantitative Analysis of UC-MSC and Myocardium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expressions of SDF-1, CXCR4, and VEGF mRNA were detected in UC-MSC and myocardium, respectively. The total RNA was extracted with TRIzol reagent (Invitrogen, United States) according to the manufacturer’s instructions, and the concentration of the total RNA was quantified with NanoDrop1000 at value ratio of 260 and 280 nm. cDNA was obtained by reverse transcription PCR using TaqMan Reverse Transcription Reagents (Roche, Switzerland) according to manufacturer’s instruction. Quantitative real-time PCR was performed using SYBR GREEN PCR Master Mix (Roche, Switzerland) and in using a CFX96TM Real-Time PCR Detection System (Bio-Rad, United States). The mRNA quantity was normalized with the house-keeping gene β-actin and GAPDH. The primer sequences are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!