Qpcr mastermix plus for sybr green 1

Frozen samples were microdismembrated and total RNA was isolated using
the RNeasy Plus Micro kit (Qiagen-Benelux, Venlo, the Netherlands).
Three hundred nanograms RNA were reverse transcribed to cDNA using the
RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific,
Bleiswijk, the Netherlands). mRNA expression was measured for
COMP, B2M, TNFA, IL6, and UBCwith qPCR Mastermix Plus for SYBR Green I (Eurogentec, Nederland B.V.,
Maastricht, the Netherlands). For ADAMTS4, ADAMTS5, GAPDH,
MMP1, MMP3, and MMP13, TaqMan Master
Mix (ABI, Branchburg, NJ, USA) was used. Primer sequences were as
follows:
Data were analyzed using the Livak method (2^−ΔΔCT). For the
set of experiments of osteochondroprogenitor cells, the reference gene
used was GAPDH. For the set of experiments using
synovial explants, normalization was based on the BestKeeper Index
(BKI) using the genes GAPDH, UBC, and
B2M. Gene expression was expressed relative to
the untreated condition.

Total RNA was isolated from homogenized tissues (whole bodies or hemocytes) using the RNeasy micro plus kit (Qiagen) and quantified with a nanodrop (Agilent). First-strand cDNA was generated from 500 ng RNA using iScript cDNA synthesis kit, according to standard procedures (Biorad, California, USA). Gene specific primers were designed with Primer3 software [50 (link)]. Real-time quantitative PCR was performed on a DNA Engine 2 (MJ Research, Minnesota, USA) with qPCR MasterMix Plus for SYBR green I (Eurogentec, Belgium) using one internal reference transcript (elongation factor 1-α, NCBI RefSeq XM_001951252.2). Running parameters were 95°C for 10 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, 68°C for 30 s. All amplifications were performed in triplicate assays. Signal intensity was measured at the end of each elongation phase and results were analyzed using the Opticon 3.1 software provided by MJ Research. To assess the specificity of the PCR amplification, a melting curve analysis of the amplicon was performed at the end of each reaction and a single peak was always observed. Standard curves were established with four serial dilutions of first-strand cDNAs, ranging from 1/10 to 1/10000. ApMIFs expression levels were normalized to expression of the internal control elongation factor 1-α (EF1) using the comparative CT method (Applied biosystems, USA).

RNA was isolated from ten whole flies per replicate from the following genotypes: tubP-Gal4/UAS-slgA-A; tubP-Gal80^ts, tubP-Gal4/UAS-slgA-B; tubP-Gal80^ts, tubP-Gal4/UAS-slgA-C; tubP-Gal80^ts, tubP-Gal4/UAS-slgA-D; tubP-Gal80^ts, tubP-Gal4/UAS-slgA-E; tubP-Gal80^ts, tubP-Gal4/UAS-PRODH; tubP-Gal80^ts (flies kept at 18°C versus flies kept at 18°C during development and switched to 29°C after eclosion and 4 days prior to RNA extraction). Flies were collected in 1 ml of TRI reagent (Sigma-Aldrich, Diegem, Belgium) and ground with a plastic disposable pestle. Total RNA was isolated using standard procedures. Two replicates per genotype were analyzed.
cDNA was generated from 1 μg of RNA of each sample by using an anchored oligo(dT)₁₈ primer according to the manufacturer's instructions (Transcriptor first-strand cDNA synthesis kit; Roche, Vilvoorde, Belgium). qRT-PCR was performed on an ABI7000 instrument with qPCR Mastermix Plus for SYBR Green I (Eurogentec, Seraing, Belgium) with the following primers: slgA-F, ACGCTGGGCGACAATAAGG; slgA-R, GGAACAAATGCAAAATTCCCTCC; RpII140-F, TTCCCCGATCACAATCAGAGT; RpII140-R, ATATAAACGCCCATAGCTTGCTTAC. Expression levels of transcripts from the various samples were normalized to RpII140 expression.