Hybond n nylon filter

To validate that miRNA-940 is cardiac specific or enriched, total RNAs from human tissues including lung, pancrease, heart, brain, kidney, skeletal muscle, spleen, liver, bladder, stomach, colon, intestine (Applied Biosystems) were separated on a 10% acrylamide TBE-urea mini-gel (Applied Biosystems) and then electroblotted onto Hybond N+ nylon filter (Amersham Biosciences, Amersham, UK). An end-labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for miRNA-940 (GGGGAGCGGGGGCCCTGCCTT) was hybridized to the filter in Rapidhyb buffer (Amersham Biosciences). The blot was reprobed for U6 to control for equal loading according to the manufacturer's protocol (Amersham Biosciences).

Total RNA was extracted from 5 × 10⁵ cells (MOI: 3 PFU/cell) using the RNeasy kit (Qiagen, Hilden, Germany). RNA was assessed for its quality by 1% agarose gel electrophoresis and for its quantity by spectrophotometric measurement. After treatment with RNase-free DNase-1 (NEB), the RNA was fractionated by electrophoresis on a 1% agarose-formaldehyde gel. After transfer under high salt conditions to a Hybond-N+ nylon filter (Amersham, London, UK), the samples were prehybridized with salmon sperm DNA (100 μg/ml) and hybridized overnight at 42 °C with a ³²P-labeled randomly primed specific VP DNA probe in the presence of 50% formamide and 5% dextran sulfate (Northern Max kit, Life Technologies, Carlsbad, CA, USA). Membranes were then washed under highly stringent conditions and autoradiographed.

High molecular weight DNA from 0–12 h Drosophila embryos was prepared in agarose plugs as previously described by Ref. 25 (link),55 (link),56 (link). Restriction enzyme digestions were performed following the suppliers’ recommendations. DNA was analyzed by pulsed-field gel electrophoresis using a “Waltzer” apparatus40 (link), and transferred to Hybond N⁺ nylon filters (Amersham) in 0.4 M NaOH.
The dodeca satellite probe was pBK6E21825 (link). The 10 bp satellite oligo probe was 5′-AATAACATAGAATAACATAGAATAACATAGAATAACATAGAATAACATAG-3′. The centromeric IGS (cIGS) probe (5.6 kb fragment) was obtained from BACR31J03 using the primers: cIGS-Fw: 5′-TGGCAGCGTTTTAAGGGATG-3′ and cIGS-Rv: 5′-TAAGACGCCTGCAGAGAACG-3′. The PCR was carried out as described by57 (link). The PCR product was cloned in vector pGEM-T (Promega). Plasmid probes were ³²P-labeled by random-priming and oligonucleotide probes were ³²P-labeled with T4 polynucleotide kinase. The BAC clones were sequenced at The Wellcome Trust Sanger Institute by the standard shotgun sequencing and directed finishing approach. The GenBank accession number for the sequence of BAC19P07, BAC16A01, BAC12I02, CH221-29J09 and CH221-27P10 are CU311183, CR942806, CR942807, CU463787 and CU313318, respectively.

Standard recombinational DNA methods were used as described previously [109 , 110 ]. Genomic DNA from C. purpurea was prepared from lyophilized mycelia according to Cenis [111 (link)]. PCR was performed as described in [110 ] using BioTherm Polymerase (GeneCraft). PCR amplifications of fusion proteins or complementation fragments were performed using the proof reading Phusion polymerase (Finnzymes). All primers used are listed in Additional file 13 and were synthesized by Biolegio (Nijmegen). Southern blotting was performed using Hybond-N⁺ nylon filters (Amersham) according to the manufacturer’s protocol. Filters were hybridized using [α-^32P]-dCTP-labelled probes. DNA sequencing was carried out as described in [29 (link)]. Protein and DNA sequence alignment, editing and organization were done with DNA Star (Madison). Further sequence analyses were performed using BLAST at the National Center for Biotechnology Information, Bethesda, MD, USA [112 (link)].