Psgfp2 c1

Manufactured by Addgene

PSGFP2-C1 is a plasmid vector that contains the gene for a green fluorescent protein (GFP) variant, PSGFP2. This vector can be used for the expression and localization of GFP fusion proteins in mammalian cells.

Automatically generated - may contain errors

Lab products found in correlation

Site directed mutagenesis kit, by Agilent Technologies (1 mentions) Pmscarlet c1, by Addgene (1 mentions)

2 protocols using psgfp2 c1

TRPV1 Mutant Generation and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Arg557Ala, Arg557Asp, Arg575Ala and Arg575Asp mutants of TRPV1 were prepared by using site directed mutagenesis kit (Agilent Technologies) using specific primer sets. In all cases, the full-length rTRPV1 cloned in pCDNA3.1 was used as a template. After mutagenesis, full length rTRPV1-Wt and all mutants were cloned into pSGFP2-C1 (Addgene) using
5′CCAGGAATTCTATGGAACAACGGGCTAGC 3′ and
5′ CCAGGTCGACTTATTTCTCCCCTGGGACC 3′ primer sets having EcoR1 and SalI site respectively.
All these constructs were verified by restriction digestion and subsequently by sequencing. In this study, TRPV1-Arg557Ala-GFP, TRPV1-Arg557Asp-GFP, TRPV1Arg575Ala-GFP and TRPV1-Arg575Asp-GFP have been collectively termed as LWI mutants.

Saha S., Ghosh A., Tiwari N., Kumar A., Kumar A, & Goswami C. (2017). Preferential selection of Arginine at the lipid-water-interface of TRPV1 during vertebrate evolution correlates with its snorkeling behaviour and cholesterol interaction. Scientific Reports, 7, 16808.

+ Open protocol

+ Expand

Cloning CD37 Promoter-Driven GFP Construct

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid psGFP2-C1 (Addgene Plasmid #22881) was digested with AseI and AgeI restriction enzymes (New England BioLabs) to remove the cytomegalovirus (CMV) enhancer and promoter sequence. A region of approximately 2 kb upstream of the CD37 transcription start site (chr19:49 836,812-49 838,766 [GRCh37/hg19]) was amplified from genomic DNA of SU-DHL-5 cells (supplemental Table 2) and ligated into digested psGFP2-C1 to replace the CMV enhancer and promoter region. Cell lines were cotransfected with CMV promoter-GFP (green fluorescent protein) or CD37 promoter-GFP construct and pmScarlet-C1 (Addgene plasmid #85042) as the transfection loading control. In case of cotransfection of the CD37 promoter-GFP with PU.1 and/or IRF2 (both in pCDNA3.1, Genscript), pIRF670-N1 plasmid^{22 (link)} was used as a loading control. If required, pCDNA3.1 empty vector was added to obtain equal amounts of total plasmid DNA. Fluorescent protein expression was analyzed by flow cytometry 24 hours after transfection. Viable cells were gated on positive expression of Scarlet and/or GFP, and the percentage of GFP-expressing cells within this population was determined.

Elfrink S., ter Beest M., Janssen L., Baltissen M.P., Jansen P.W., Kenyon A.N., Steen R.M., de Windt D., Hagemann P.M., Hess C., van Spronsen D.J., Hoevenaars B., van der Spek E., Xu-Monette Z.Y., Young K.H., Kaffa C., Bervoets S., van Heek J., Hesius E., de Winde C.M., Vermeulen M., van den Brand M., Scheijen B, & van Spriel A.B. (2022). IRF8 is a transcriptional activator of CD37 expression in diffuse large B-cell lymphoma. Blood Advances, 6(7), 2254-2266.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!