Anti gapdh

Manufactured by Fortrea

Anti-GAPDH is a laboratory reagent used for the detection and quantification of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein in biological samples. GAPDH is a commonly used housekeeping gene and its expression is often used as a reference for normalizing other gene expression data.

Automatically generated - may contain errors

Lab products found in correlation

Imagequant las 4000 imaging system, by GE Healthcare (1 mentions) Ecl reagent, by Cytiva (1 mentions) Pvdf membrane, by Cytiva (1 mentions) Imagequant software, by GE Healthcare (1 mentions) Anti ha, by Merck Group (1 mentions) Protease inhibitor, by Merck Group (1 mentions) Anti actin, by Abcam (1 mentions) Pvdf membrane, by GE Healthcare (1 mentions) Anti tnfr1, by Abcam (1 mentions) Anti gfp, by Cell Signaling Technology (1 mentions) Quantity one software, by Bio-Rad (1 mentions) Rabbit anti tbk1, by Abcam (1 mentions) Control mouse igg, by Santa Cruz Biotechnology (1 mentions) Control rabbit igg, by Merck Group (1 mentions) Hrp conjugated goat anti mouse or rabbit igg, by Thermo Fisher Scientific (1 mentions) Anti ubiquitin, by Merck Group (1 mentions) Hrp conjugated mouse anti flag, by Merck Group (1 mentions) Anti p tbk1, by Abcam (1 mentions) Anti usp49, by Proteintech (1 mentions) Anti ha, by Fortrea (1 mentions)

Close spelling variants of this product

GAPDH (3 citations)

3 protocols using anti gapdh

Immunoblotting for Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein extracts from cells were prepared and incubated on ice for 45 minutes in lysis buffer (150 mM NaCl, 50 mM Tris-HCl pH 7.0, 1% Triton X-100, 0.1% SDS) containing protease inhibitors (Sigma, UK). Following centrifugation to clarify lysates, protein levels were then quantified using the BCA assay kit (Pierce, UK). Proteins were run on a 10% SDS-PAGE gel and transferred onto a PVDF membrane (Amersham Biosciences, UK). Membranes were blocked in 5% nonfat-dried milk (Sigma) PBS-Triton and probed with anti-HA (Sigma, 1∶1000) or anti-GAPDH (Covance, 1∶1000) antibodies and secondary HRP-conjugated antibody (1∶5000, Invitrogen). Proteins were visualized using ECL reagent according to the manufacturer’s instructions (Amersham Biosciences) using an ImageQuant LAS4000 imaging system and ImageQuant software (GE Healthcare, UK).

Moore J.M., Oliver P.L., Finelli M.J., Lee S., Lickiss T., Molnár Z, & Davies K.E. (2014). Laf4/Aff3, a Gene Involved in Intellectual Disability, Is Required for Cellular Migration in the Mouse Cerebral Cortex. PLoS ONE, 9(8), e105933.

+ Open protocol

+ Expand

Western Blot Protocol for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Capillaries and cell homogenates were collected in RIPA buffer with 1% SDS. Samples containing equal total protein amounts were separated by SDS-PAGE using 12% or 4–15% gels (Bio-Rad, CA) and transferred to polyvinylidine fluoride (PVDF) membranes (GE Healthcare, NJ). Membranes were blocked by 5% milk or 3% BSA prepared in TBS with Tween (TBST) and exposed to primary antibody for 1 h at room temperature or overnight at 4 °C. Primary antibodies were anti-P-gp (mouse monoclonal C219, Covance; 1:50), anti-GAPDH (monoclonal mouse, Fitzgerald 1:20,000), anti-GFP (rabbit polyclonal, Living Colors 1:3,000), anti-phosphorylated protein kinase-CβII, anti-PKCβII (Rabbit polyclonal 1:2000, Cell Signaling, MA), anti-tumor necrosis factor-1, anti-TNFR1 (Rabbit polyclonal 1:2000, Abcam, MA), or anti-actin (Mouse monoclonal 1:4000, Abcam, MA). Following three washes with TBST, 15 min each, membranes were incubated with secondary antibody (1:1000 for anti-mouse and anti-rabbit IgG) for 1 h at room temperature, washed again and developed using ECL Prime reagents for chemiluminescent detection (Bio-Rad Quantity-One Detection System). Protein bands were quantified using Quantity-One software (Bio-Rad, CA).

Qosa H., Lichter J., Sarlo M., Markandaiah S.S., McAvoy K., Richard J.P., Jablonski M.R., Maragakis N.J., Pasinelli P, & Trotti D. (2016). Astrocytes drive upregulation of the multidrug resistance transporter ABCB1 (P-glycoprotein) in endothelial cells of the blood-brain barrier in mutant superoxide dismutase 1-linked amyotrophic lateral sclerosis. Glia, 64(8), 1298-1313.

+ Open protocol

+ Expand

Antibodies and Nucleic Acid Probes for Immunoblotting

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), HRP-conjugated mouse anti-FLAG (Sigma, A8592)(1:1000), mouse anti-FLAG (Sungene, KM8002)(1:2000), anti-GFP (Sungene, KM8009)(1:2000) anti-β-Actin (KM9001)(1:2000), anti-Tubulin (KM9003), anti-GAPDH(KM9002), anti-HA (COVANCE, MMS-101R)(1:2000), anti-Ubiquitin (sc-8017)(1:500), anti-Ubiquitin K63-specific linkage (Millipore 05–1308)(1:500), rabbit anti-TBK1(Abcam, 96328–11), anti-p-TBK1(Abcam, 109272), anti-IRF3 (sc-9082)(1:1000), anti-p-IRF3 (Cell Singling Technologies, 4947S)(1:1000), anti-IκBα (sc-371)(1:1000), anti-p-IκBα (Cell Singling Technologies, 9246L)(1:1000), anti-USP49 (proteintech,18066-1-AP), anti-mouse MITA and anti-human MITA (Cell Singling Technologies,13647) (proteintech, 19851-1-AP) were purchased from the indicated manufactures. ISD45, DNA90, and HSV120 were previously described [44 (link), 45 (link), 72 (link), 73 (link)]. ISD45: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; DNA90: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; HSV120: 5’-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3’.

Ye L., Zhang Q., Liuyu T., Xu Z., Zhang M.X., Luo M.H., Zeng W.B., Zhu Q., Lin D, & Zhong B. (2019). USP49 negatively regulates cellular antiviral responses via deconjugating K63-linked ubiquitination of MITA. PLoS Pathogens, 15(4), e1007680.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!