Immunoblotting analysis was carried out as previously described35 using an anti‐phospho Akt antibody (1:2,000; #4060; Cell Signaling Technology, Waltham, MA, USA) or glyceraldehyde 3‐phosphate dehydrogenase antibody (1:4,000; #2118; Cell Signaling Technology). The quantification was carried out with ImageJ software (National Institutes of Health, Bethesda, MD, USA). Phosphorylation was expressed as percent phospho‐AKT relative to glyceraldehyde 3‐phosphate dehydrogenase; the values in GCGKO mice are shown relative to control mice.
Glyceraldehyde 3 phosphate dehydrogenase antibody
Manufactured by Cell Signaling Technology
Sourced in United States
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a housekeeping enzyme involved in glycolysis. The GAPDH antibody is a tool used to detect and quantify GAPDH protein expression in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Ab150117, by Abcam (3 mentions)
Ab52939, by Abcam (3 mentions)
Ab131522, by Abcam (3 mentions)
Anti atp6v0a3 antibody, by Novus Biologicals (3 mentions)
Ab93926, by Abcam (2 mentions)
Ab150084, by Abcam (2 mentions)
A11011, by Thermo Fisher Scientific (2 mentions)
Fak antibody, by Cell Signaling Technology (2 mentions)
Ab150081, by Abcam (2 mentions)
Ab150120, by Abcam (2 mentions)
Pf 00562271, by Selleck Chemicals (2 mentions)
Eipa a3085, by Merck Group (2 mentions)
Licl l4408, by Merck Group (2 mentions)
Baf s1413, by Selleck Chemicals (2 mentions)
Pma 1201, by Bio-Techne (2 mentions)
Tmr dextran 70 kda, by Thermo Fisher Scientific (2 mentions)
S2672, by Selleck Chemicals (2 mentions)
A11001, by Thermo Fisher Scientific (2 mentions)
Hpa018123, by Atlas Antibodies (2 mentions)
Anti phospho akt antibody, by Cell Signaling Technology (1 mentions)
8 protocols using glyceraldehyde 3 phosphate dehydrogenase antibody
1
Quantifying Phospho-AKT Levels
2
Protein Expression Quantification by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot was performed according to standard methods as described previously (Li et al., 2008 (link)), using anti-MDK and anti-SP1 (Santa Cruz Biotechnology), anti-AKT, anti-p-AKT, anti-ERK, anti–CDK-4, and anti–CDK-6 antibodies (Cell Signaling Technology, Boston, MA). The membranes were stripped and reprobed with an anti–α-tubulin antibody (Sigma-Aldrich, St. Louis, MO) or glyceraldehyde-3-phosphate dehydrogenase antibody (Cell Signaling Technology) as a loading control. After washing, the membranes were incubated with horseradish peroxidase–conjugated goat anti–mouse or anti–rabbit secondary antibodies (Jackson ImmunoResearch, West Grove, PA) and visualized using enhanced chemiluminescence reagents (Forevergen Biosciences, Guangzhou, China).
3
Curcumin's Anti-Apoptotic and Antioxidant Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Curcumin was obtained from Sigma Chemical Co (St Louis, MO, USA). Dulbecco’s Modified Eagle Medium/Ham’s F-12 (1:1), trypsin-ethylenediaminetetraacetic acid solution, penicillin, streptomycin solution, and fetal bovine serum were obtained from Gibco (Carlsbad, CA, USA). Phenylmethylsulfonyl fluoride and 3-(4,5-dimethylthioazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) were sourced from Sigma Chemical Co. The Annexin V-fluorescein isothiocyanate apoptosis detection kit was obtained from Beyotime Biotechnology Co Ltd (Shanghai, People’s Republic of China). The ROS detection kit was obtained from Wiig Lars Biological Technology Co Ltd (Beijing, People’s Republic of China). Rabbit polyclonal antibody against caspase-3 was purchased from Abcam (Cambridge, MA, USA). Bcl-2 and Bax were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The glyceraldehyde-3-phosphate dehydrogenase antibody was purchased from Cell Signaling Technology (Danvers, MA, USA). Superoxide dismutase (SOD), maleic dialdehyde (MDA), and glutathione (GSH) test kits were obtained from Beyotime Biotechnology Co Ltd.
4
Comprehensive Antibodies and Reagents Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total β-catenin antibody (1:1,000) was purchased from Invitrogen (712700), glyceraldehyde-3-phosphate dehydrogenase antibody (1:1,000) and FAK antibody (1:1,000, 3285) were obtained from Cell Signaling Technologies, anti-ATP6V0a3 antibody (1:500) was obtained from Novus (nbp1–89333, 1:1,000). CD63 antibody was obtained from Abcam.
Antibodies against Pak1 (ab131522), Ras (ab52939), GSK3 (ab93926, 1:4000), and secondary antibodies for immunostaining for cells (ab150120, ab150084, ab150117, ab150081) (1:300) were obtained from Abcam. Antibody against the focal adhesion protein Tes (HPA018123, 1:100) was obtained from Atlas antibodies. Secondary antibodies for immunostaining arrays (A-11001, A-11011 were obtained from Invitrogen). HRP-linked secondary antibodies (7076, 7074 at 1:5000 (Cell Signaling) were used for Western blots and analyzed with an iBright Imaging system. EIPA (A3085), and LiCl (L4408), were obtained from Sigma. Baf (S1413) and PF-00562271 (FAK inhibitor, S2672) were purchased from Selleckchem. TMR- dextran 70 kDa was obtained from ThermoFisher (D1818). PMA (1201) was purchased from TOCRIS.
Antibodies against Pak1 (ab131522), Ras (ab52939), GSK3 (ab93926, 1:4000), and secondary antibodies for immunostaining for cells (ab150120, ab150084, ab150117, ab150081) (1:300) were obtained from Abcam. Antibody against the focal adhesion protein Tes (HPA018123, 1:100) was obtained from Atlas antibodies. Secondary antibodies for immunostaining arrays (A-11001, A-11011 were obtained from Invitrogen). HRP-linked secondary antibodies (7076, 7074 at 1:5000 (Cell Signaling) were used for Western blots and analyzed with an iBright Imaging system. EIPA (A3085), and LiCl (L4408), were obtained from Sigma. Baf (S1413) and PF-00562271 (FAK inhibitor, S2672) were purchased from Selleckchem. TMR- dextran 70 kDa was obtained from ThermoFisher (D1818). PMA (1201) was purchased from TOCRIS.
5
Immunoblot Analysis of Mitochondrial Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were homogenized using a TissueLyser II (Qiagen) in lysis buffer containing 50 mM tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA (pH 8.0), and 0.1% Triton X-100. The supernatants were obtained by centrifugation at 16,000g for 15 min, and the protein concentrations were measured using a protein assay dye. Protein (5 μg) from each sample was loaded onto 10% polyacrylamide gels and subjected to electrophoresis. The separated proteins were transferred onto a 0.45-μm nitrocellulose membrane at 400 mA for 2 hours. The membrane was blocked with 5% skimmed milk for 1 hour and then incubated with primary antibodies overnight at 4°C. After incubation with a horseradish peroxidase (HRP)–conjugated secondary antibody for 2 hours at room temperature, the membrane was visualized using the WesternBright ECL Spray (Advansta). The following antibodies were used for detection: CRIF1 antibody (Santa Cruz Biotechnology), Total OXPHOS Rodent WB Antibody Cocktail (Abcam), glyceraldehyde-3-phosphate dehydrogenase antibody (Cell Signaling Technology), HRP-linked anti-mouse IgG antibody (Cell Signaling Technology), and HRP-conjugated goat anti-rabbit IgG (H+L) (Bio-Rad).
6
Lysosome-targeting Reagents in Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiR-Lysosome was purchased from Cytoskeleton (CYSC012, used at 1 μM).
HCQ (H0915), CQ diphosphate (C 6628), EIPA (A3085), LiCl and sodium chloride (NaCl) (S9888), IPA-3 (I2285, used at 2.5 μM), and Concanamycin A (C9705, used at 5 μM) were obtained from Sigma. Baf (S1413) was purchased from Selleckchem. TMR-dextran 70,000 kDa was purchased from ThermoFisher (D1818). Total β-catenin antibody (1:1,000) was purchased from Invitrogen (712700), glyceraldehyde-3-phosphate dehydrogenase antibody (1:1,000) was obtained from cell signaling, anti-ATP6V0a3 antibody (23 (link)) was obtained from Novus (nbp1-89333, 1:1,000). Antibodies against Pak1 (ab131522) and Ras (ab52939) and secondary antibodies for immunostaining (ab150083, ab150117) (1:500) were obtained from Abcam. Wnt3a protein was from Peprotech (315-20) and used at 100 ng/mL. Hrs-MO TGCCGCTTCCTCTTCCCATTGCGAA (9 (link)) was from Gene Tools and microinjected as 4 nL of 0.3 mM MO.
HCQ (H0915), CQ diphosphate (C 6628), EIPA (A3085), LiCl and sodium chloride (NaCl) (S9888), IPA-3 (I2285, used at 2.5 μM), and Concanamycin A (C9705, used at 5 μM) were obtained from Sigma. Baf (S1413) was purchased from Selleckchem. TMR-dextran 70,000 kDa was purchased from ThermoFisher (D1818). Total β-catenin antibody (1:1,000) was purchased from Invitrogen (712700), glyceraldehyde-3-phosphate dehydrogenase antibody (1:1,000) was obtained from cell signaling, anti-ATP6V0a3 antibody (23 (link)) was obtained from Novus (nbp1-89333, 1:1,000). Antibodies against Pak1 (ab131522) and Ras (ab52939) and secondary antibodies for immunostaining (ab150083, ab150117) (1:500) were obtained from Abcam. Wnt3a protein was from Peprotech (315-20) and used at 100 ng/mL. Hrs-MO TGCCGCTTCCTCTTCCCATTGCGAA (9 (link)) was from Gene Tools and microinjected as 4 nL of 0.3 mM MO.
7
Cell Signaling Pathway Antibody Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total β-catenin antibody (1:1000) was purchased from Invitrogen (712700), glyceraldehyde-3-phosphate dehydrogenase antibody (1:1000) and FAK antibody (1:1000, 3285) were obtained from Cell Signaling Technologies, anti-ATP6V0a3 antibody (1:500) was obtained from Novus (nbp1-89333, 1:1000). CD63 antibody was obtained from Abcam.
Antibodies against Pak1 (ab131522), Ras (ab52939), GSK3 (ab93926, 1:4000), and secondary antibodies for immunostaining for cells (ab150120, ab150084, ab150117, ab150081) (1:300) were obtained from Abcam. Antibody against the FA protein Tes (HPA018123, 1:100) was obtained from Atlas antibodies. Secondary antibodies for immunostaining arrays (A-11001, A-11011 were obtained from Invitrogen). HRP-linked secondary antibodies 7076, 7074 at 1:5000 (Cell Signaling) were used for western blots and analyzed with an iBright Imaging system. EIPA (A3085), and LiCl (L4408), were obtained from Sigma. Baf (S1413) and PF-00562271 (FAK inhibitor, S2672) were purchased from Selleckchem. TMR-dextran 70 kDa was obtained from Thermo Fisher (D1818). PMA (1201) was purchased from TOCRIS.
Antibodies against Pak1 (ab131522), Ras (ab52939), GSK3 (ab93926, 1:4000), and secondary antibodies for immunostaining for cells (ab150120, ab150084, ab150117, ab150081) (1:300) were obtained from Abcam. Antibody against the FA protein Tes (HPA018123, 1:100) was obtained from Atlas antibodies. Secondary antibodies for immunostaining arrays (A-11001, A-11011 were obtained from Invitrogen). HRP-linked secondary antibodies 7076, 7074 at 1:5000 (Cell Signaling) were used for western blots and analyzed with an iBright Imaging system. EIPA (A3085), and LiCl (L4408), were obtained from Sigma. Baf (S1413) and PF-00562271 (FAK inhibitor, S2672) were purchased from Selleckchem. TMR-dextran 70 kDa was obtained from Thermo Fisher (D1818). PMA (1201) was purchased from TOCRIS.
8
Cardiac Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three hours after reperfusion, area at risk of the heart was harvested for Western blot analysis. Total protein was extracted from homogenized heart tissue using complete protease inhibitor cocktail and RIPA lysis buffer (Beyotime Biotechnology, Nanjing, China). Then, equal amounts of proteins were subjected to 10% to 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis based on the molecular weight of target proteins and transferred to polyvinylidene difluoride membranes. The membranes were blocked for 2 h at room temperature with 5% milk and then incubated with specific primary antibodies overnight at 4°C, followed by incubation for 1 h with the secondary antibody conjugated horseradish peroxidase. The protein bands were visualized by enhanced chemiluminescence and quantified by densitometry. The primary antibodies against Bax (Cell Signaling Technology, Beverly, Mass), Bcl-2 (Cell Signaling Technology, Beverly, Mass), GRP78 (Abcam, Cambridge, Mass), CHOP (Cell Signaling Technology, Beverly, Mass), and Caspase12 (Abcam, Cambridge, Mass) were used. Glyceraldehyde-3-phosphate dehydrogenase antibody (Cell Signaling Technology, Beverly, Mass) served as the loading control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!