in vitro delivery of miR-3064-5p inhibitor-loaded exosomes to EASCs by incubating in culture medium. After 24 h, the expression of miR-3064-5p in EASCs was detected using qPCR. Briefly, total RNA was reverse transcribed using the MicroRNA Reverse Transcription Kit (Haoqinbio Inc., Shanghai, China) with specialized primers according to the manufacturer's instruction. RNU6 was used as a housekeeping reference. The synthesized first-strand cDNA samples were subjected to qPCR using hsa-miR-3064-5p specific TaqMan primer (Applied Biosystems, Foster City, USA) and TaqMan Universal PCR Master Mix in an ABI Prism 7700 Sequence Detector (ThermoFisher, Waltham, MA, USA). The oligonucleotide primer sequence of Nnat was designed using Primer 5.0 software and GAPDH was used as an internal control. The synthesized first-strand cDNA samples were subjected to qPCR using a SYBR Green PCR Master Mix (Toyobo Bio-Technology, Shanghai, CHN) and the qPCR reaction was also performed on the ABI Prism 7700 Sequence Detector (ThermoFisher).
Abi prism 7700 sequence detector
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom, Japan, Germany
The ABI Prism 7700 Sequence Detector is a real-time PCR system designed for quantitative gene expression analysis. It utilizes fluorescent probes to detect and quantify specific DNA sequences during the amplification process. The system provides accurate and sensitive detection of target sequences in a wide range of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (24 mentions)
Rneasy mini kit, by Qiagen (14 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (10 mentions)
Sequence detector v1.7a, by Thermo Fisher Scientific (8 mentions)
Trizol, by Merck Group (8 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (7 mentions)
Trizol agent, by Thermo Fisher Scientific (5 mentions)
Bestar qpcr rt kit, by DBI Bioscience (4 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Sybergreen mixture, by DBI Bioscience (4 mentions)
Sybr green pcr master mix, by Toyobo (4 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (4 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Sybr green pcr master mix, by Takara Bio (3 mentions)
Wizard genomic dna purification kit, by Promega (3 mentions)
Sybr green pcr kit, by Thermo Fisher Scientific (3 mentions)
Viia7, by Thermo Fisher Scientific (3 mentions)
Gapdh, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
123 protocols using abi prism 7700 sequence detector
1
In vitro delivery of miR-3064-5p inhibitor-loaded exosomes to EASCs
2
Quantifying EBV Viral Loads in Murine Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from whole blood and serum was extracted with the NucliSENS EasyMAG System (Biomérieux) and DNA from splenic tissues was isolated using the DNeasy Blood and Tissue kit (QIAGEN), according to the manufacturer’s recommendations. Taqman real-time PCR was used to quantify EBV viral loads using modified primers (5′-CTTCTCAGTCCAGCGCGTTT-3′ and 5′-CAGTGGTCCCCCTCCCTAGA-3′) and a fluorogenic probe (5′-FAM CGTAAGCCAGACAGCAGCCAATTGTCAG-TAMRA-3′) to detect the conserved EBV BamHI-W fragment. Blood and splenic tissue viral loads from SMAC-mimetic treated mice were analyzed on an ABI Prism 7700 Sequence detector (Applied BioSystems) and run in duplicates, with EBV loads indicated in EBV genome copy numbers. EBV load in serum of SMAC-mimetic treated mice and LCL-transfer experiment samples were analyzed in triplicates and run on a CFX384 Touch Real-time PCR Detection System (Bio-Rad), indicating EBV International Units (IU).
3
Quantifying Butyrate-Producing Genes in Pig Gut
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qPCR was performed in triplicate for the DNA extracted from each sample to assess the gene copy number of the butyrate-producing functional genes, namely, butyrate kinase and butyryl CoA: acetate CoA transferase, in pig intestinal contents on an ABI Prism 7700 Sequence Detector (Applied Biosystems) [22 (link), 23 (link)] using gene-specific primers (see Supplementary Tables S2 ) and SYBR Green PCR Master Mix (Takara, Tokyo, Japan). The thermal cycling system was 95°C for 2 min, 35 cycles of 15 s at 95°C, 45 s at 58°C, and 1 min at 72°C. The specificity of the reaction for each gene was verified by a melting curve analysis. Standard curves from known quantities of plasmid DNA were used to determine the copy number of each gene. The data from qPCR experiments was represented as gene copies per gram of luminal content.
4
Quantification of Liver RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA isolation, liver was fixed immediately in RNA stabilization reagent (RNAlater; Qiagen, Valencia, CA), and the samples were homogenized. Total RNA was extracted using an RNeasy Mini kit (Qiagen). Complementary DNA was synthesized using a Ready-To-Go T-Primed First-Strand kit (Amersham Biosciences, Tokyo, Japan). The primer and probe sets for TNF-α, IL-6 and cystathionine β-synthase (CBS) were from Applied Biosystems (Foster City, CA). Real-time PCR was performed on an ABI PRISM 7700 Sequence Detector (Applied Biosystems) using the following parameters: 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 s and primer extension at 60°C for 1 min. The expression level of each gene was first normalized to that of the glyceraldehyde-3-phosphate dehydrogenase gene in the same sample. The data are shown as means ± SD.
5
Quantitative RT-PCR Analysis of DCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from resting or CpG ODN-treated DCs were isolated with the Nucleospin RNA Plus extraction kit (Macherey-Nagel, Hoerdt, France), and cDNA were synthesized from 1 mg of total RNA with random hexamer primers and Superscript III (Invitrogen, Cergy Pontoise, France) according to standard procedures. cDNAs were used as templates for PCR amplification with the SYBR Green PCR Master Mix (Molecular Probes, Leiden, the Netherlands) and the ABI PRISM 7700 Sequence Detector (Applied Biosystems, Foster City, CA). Primers, which are listed in S2 Table , were designed by the Primer Express Program (Applied Biosystems) and used for amplification in triplicate assays. PCR amplification of Gapdh was performed to control for sample loading and to allow normalization between samples. ΔCt values were obtained by deducting the raw cycle threshold (Ct values) obtained for Gapdh mRNA, the internal standard, from the Ct values obtained for investigated genes. For graphical representation, data are expressed as relative expression of mRNA levels.
6
Quantitative RT-PCR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from homogenized mouse liver or cell lysates using Qiazol reagent (Qiagen, Hilden, DEU). cDNA was prepared by reverse transcription using the M-MuLV enzyme and Oligo dT primer (Fermentas, St. Leon-Rot, DEU). cDNAs were amplified using assay-on-demand kits and an ABIPRISM 7700 Sequence detector (Applied Biosystems, Darmstadt, DEU). RNA expression data was normalized to levels of TATA-box binding protein (TBP) RNA. Particular product numbers for probe sets can be provided upon request.
7
TRAIL-induced IP-10 Gene Expression
8
Quantitative RT-PCR for Osteogenic Markers
9
Liver Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from the livers of WT and KO males using Trizol. cDNAs were synthesized using SuperScript first strand synthesis system (Invitrogen) with random hexamers as primers. Real-time PCR was performed with an ABI Prism 7700 sequence detector (Applied Biosystems, Foster City, CA), TaqMan Universal PCR reaction mix and primers (Applied Biosystems) for mouse Cyp2b10, Cyp2c55 or glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as a control.
10
Validation of miR-135a Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the microarray results, we performed qRT-PCR to assay screen the miR-135a expression in prepared tissues samples and cell lines. Total RNA was isolated with the Trizol reagent (Invitrogen, Carlsbad, CA, USA). The expression of miR-135a was analyzed with the miScript system (Qiagen, Hilden, Germany) in accordance with the manufacturer's protocol; this system contains the miScript Reverse Transcription kit, miScript Primer assays, and miScript SYBR Green PCR kit. Human U6 RNA was amplified for normalization. SYBR green real-time RT-PCR was adopted to detect Bmi1 mRNA, and the first-strand complementary DNA was synthesized using MMLV reverse transcriptase (Epicentre, Paris, France). Human glyceraldehyde 3-phosphatedehydrogenase (GAPDH) RNA was used as an internal control. The primers used were as follows: Bmi1 forward, 5'GCTTCAAGATGGCCGCTTG3', and reverse, 5'TTCTCGTTGTTCGATGCATTTC3'. All RT-PCR reactions were analyzed using the ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA) in triplicate for each sample. The fold change for the relative expression levels of each miRNA was calculated using the ΔΔCt method 17 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!