Histrap ff crude column

Mouse mammary ERRα DBD (70–170) was cloned in the in-house expression vector pnEAtH. The vector was transformed in Escherichia coli BL21 (DE3) pRARE2 strain, grown at 37°C and induced for protein expression at OD_600nm = 0.6 with 1 mM IPTG at 25°C for 3 h. The cell pellet was resuspended in binding buffer (20 mM Tris pH = 8.0, 400 mM NaCl, 10% glycerol, 4 mM CHAPS) and lysed by sonication. The crude extract was centrifuged at 45,000 × g for 1 h at 4°C. The lysate was loaded on a Ni affinity step on HisTrap FF crude column (GE Healthcare, Inc.), and the protein was eluted at a concentration of 150 mM imidazole. The hexahistidine tag was cleaved overnight using thrombin protease. ERRα-DBD was subjected to a Heparin column using an increasing salt gradient. Finally, the ERRα-DBD was polished by size-exclusion chromatography (SEC) in a SEC buffer (50 mM Bis Tris pH = 7.0, 120 mM KCl, 0.5 mM CHAPS, 4 mM MgCl₂) by using a Superdex S75 16/60 column (GE Healthcare). Complexes were formed by mixing the appropriate DNA solution to the purified ERRα DBD to achieve desired DNA:protein molar ratios. The complex was incubated at least 30 min at 4°C before performing the respective experiments.

A synthetic gene encoding SARS-CoV-2 S (sequence derived from Genbank accession: MN908947.3) was cloned into a customized DNA vector for expression in mammalian tissue culture. Final expression constructs featured a fragment encoding the native S ectodomain, including viral signal peptide (residues 1–1214), with prefusion stabilizing and 986P, 987P variants first reported by [18 (link)]. HEK 293F-expressed S protein featured a C-terminal leucine zipper (GCN4) motif, and His₈-tag for Ni²⁺-affinity purification. Pure S-encoding plasmid DNA was transfected into HEK 293F cells (approximately 10⁶ mL⁻¹) using PEI (polyethylimine) MAX at 5:1 w/w (final culture DNA concentration approximately 1 μg mL⁻¹). After 96 h condition media supernatant was harvested by low-speed centrifugation, and recombinant S trimers were purified directly from media by IMAC using a 5 mL HisTrap FF crude column (GE). Protein-containing fractions were pooled and concentrated before application to a Superose 6 10/300 GL column (GE) for final purification via size-exclusion chromatography.

Ultracompetent E. coli were transformed with pTrcHisB vectors coding the various PPX deletion mutants. Recombinant protein expression was induced by 0.5 mM isopropylthio-β-D-galactoside (Sigma-Aldrich) at 37 °C for 4 h. Bacteria were collected by centrifugation, resuspended in binding buffer (20 mM NaH₂PO₄, 500 mM NaCl and 20 mM imidazole, pH 7.4) and lysed by sonication. Cell lysates were centrifuged (10,000 g for 10 min at 4 °C) and supernatants were loaded on 1 ml HisTrap FF crude column (GE Healthcare). Following washing, bound proteins were eluted with 20 mM NaH₂PO₄, 500 mM NaCl and 500 mM imidazole, pH 7.4. Fractions containing mutants were combined, and solvent was changed to PBS, pH 7.4, using desalting columns (Econo-Pac 10 DG, Bio-Rad). Protein concentrations were determined by the Bradford method. Coomassie brilliant blue staining assessed protein purity. Western blotting was performed using 6xHis-tag antibody (1:1,000, Merck Millipore, catalogue number #70796-3) and horseradish peroxidase (HRP)-coupled anti-mouse Fc antibody (1:5,000, Jackson ImmunoResearch, #115-035-003). Full scans of the western blots are shown in Supplementary Fig. 4.

Insolubly produced proteins were purified as described for soluble proteins with minor changes. Before loading the DTT containing supernatant, the HisTrap FF crude column (GE Healthcare) was prepared for reducing conditions according to the manufacturer’s instructions, as care has to be taken to remove all non-chelated nickel ions. Briefly, the column was equilibrated with 5 CV NiNTA buffer A, blank eluted with 5 CV NiNTA buffer B, and re-equilibrated with 5 CV “NiNTA unfold red A”. Then, the feed was loaded, washed and eluted as described above, except using “NiNTA unfold red B” (NiNTA unfold red A + 500 mM Imidazole) as elution buffer. Eluted peak fractions were collected, pooled and concentrated to a final concentration of at least 10 mg*ml⁻¹ using a 10 kDa molecular-weight cutoff spin concentrator before refolding by rapid dilution.

The ORFs encoding cysteine-protease proteins were obtained by amplification, using the following forward and reverse primers: TcCYSPRot_CatF GTTTCAGAAACATATGTTGGGAGCTGC and TcCYSPRotR AACCTCAACCCTCGAGATGGACCAACTAC, which contained restriction sites for XhoI and NdeI, respectively, for cloning into pET28a, according to standard techniques for cloning [24 ]. Transformed cells (E. coli Rosetta—DE3) containing the recombinant plasmids were grown at 37°C until reaching OD_600nm = 0.7, induced with 0.4 mM IPTG (isopropyl-β-D-thiogalactopyranoside) for 4 h, harvested, and processed. The lysate was centrifuged at 13,000 g, 4°C, for 15 min and soluble and insoluble fractions were obtained. Fusion proteins with a histidine tail were purified using a His-Trap FF Crude column (GE Healthcare), following the manufacturer’s instructions. Insoluble recombinant cacao cysteine-proteases were dissolved with buffer solution 6 M urea prior to loading onto the column, and eluted in lyses buffer containing 250 mM imidazole and 6 M urea. Protein concentration was determined by the Bradford method [25 (link)].

The PnLOXA coding sequence (Vv06s0004g01510) without the plastid targeting sequence was amplified from Pinot Noir berry cDNA using Phusion DNA polymerase (Finnzymes) and the primers LOXfw5′BamHI (5′-GGATCCGTTGGCTACGTCCCTG-3′) and LOXrev3′HindIII (5′-AAGCTTTCAAATGGAGATACTGTATGGAA-3′) and inserted into the pGEM-T vector for sequencing. PnLOXA was then transferred to the expression vector pQE30 using the BamHI/HindIII restriction sites, thus adding an N-terminal His₆ tag. Escherichia coli M15 [pRep4] cells transformed with pQE30:PnLOXA were induced with 1 mM IPTG and 2% ethanol for 16 h at 20°C. A 1-L bacterial culture pellet was resuspended in 40 ml of 50 mM HEPES/NaOH buffer (pH 7.5) containing 150 mM NaCl, 5 mM DTT and protease inhibitors (Sigma). After sonication and lysozyme treatment (0.2 mg/ml), the cleared bacterial lysate was adjusted to 0.5M NaCl and loaded onto a 5-ml HisTrap™ FF crude Column (GE Healthcare, AKTA Purifier system) pre-equilibrated with binding buffer (20 mM HEPES-NaOH pH 7.5, 0.5 M NaCl). The column was washed with binding buffer and 50 mM imidazole (Merck), and the His₆-PnLOXA protein was eluted using 250 mM imidazole. Protein yield was 2 mg of pure protein per liter of bacterial culture. Recombinant PnLOXA activity was studied using 0.1 mM α-linolenic acid (Sigma) at pH 6.5 and 25°C.