Envision xcite multilabel plate reader

Manufactured by PerkinElmer

Sourced in France, United States

The EnVision Xcite Multilabel plate reader is a versatile instrument designed for high-throughput detection and analysis of various assays in a microplate format. It provides a platform for rapid and accurate measurements of fluorescence, luminescence, and absorbance signals.

Automatically generated - may contain errors

Lab products found in correlation

Black 384 well optiplate, by PerkinElmer (3 mentions) Envision operating software, by PerkinElmer (3 mentions) Prism 5, by GraphPad (3 mentions) Alamar blue, by Thermo Fisher Scientific (3 mentions) Annexin 5, by BioLegend (2 mentions) Rpmi 1640 medium, by Corning (2 mentions) Propidium iodide, by Merck Group (2 mentions) Lsr 2 flow cytometer, by BD (2 mentions) Cell meter fluorimetric intracellular total ros activity assay kit, by AAT Bioquest (2 mentions) Operetta, by PerkinElmer (2 mentions) Hoechst 33342, by Thermo Fisher Scientific (2 mentions) Britelite, by PerkinElmer (2 mentions) Janus automated workstation, by PerkinElmer (2 mentions) 5 6 fam label, by Integrated DNA Technologies (2 mentions) Multidrop combi reagent dispenser, by Thermo Fisher Scientific (2 mentions) Ip one tb kit, by PerkinElmer (1 mentions) Optiplate, by PerkinElmer (1 mentions) Alamarblue, by PerkinElmer (1 mentions) Cytoselect brdu cell proliferation elisa kit, by Cell Biolabs (1 mentions) Pd 1 pd l1 blockade assay kit, by Promega (1 mentions)

15 protocols using envision xcite multilabel plate reader

Mitochondrial-Targeted HSP90 Antagonist Cytotoxicity

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All cells were cultured in RPMI-1640 medium (Corning Cellgro, Manassas, VA) supplemented with 5% fetal bovine serum (FBS) and grown at 37 °C in 5% CO₂. Human fibroblasts (FF2511) were isolated from foreskin samples and grown in RPMI-1640 supplemented with 10% FBS.
Cells were seeded in 96-well plates and treated with drugs. 6-thio-dG was purchased from R.I. Chemical Inc (Orange, CA). The complete chemical synthesis, HPLC profile, and mass spectrometry of mitochondrial-targeted small molecule HSP90 antagonist, Gamitrinib (GA mitochondrial matrix inhibitors) has been reported [33 (link)]. The Gamitrinib variant containing triphenylphosphonium as a mitochondrial-targeting moiety was used in this study. Cell viability was assessed following 6 h incubation with 500 µM Alamar Blue (ThermoFisher Scientific, Waltham, MA) using an EnVision Xcite Multilabel plate reader (Perkin Elmer, Waltham, MA). Cell death was determined by flow cytometry using PSVue-643 (p-1006; Molecular Targeting Technologies, West Chester PA) or Annexin V (640919; Biolegend, San Diego, CA) and Propidium Iodide (Sigma-Aldrich, St. Louis, Mo) staining. Samples were analyzed using a BD LSRII flow cytometer (BD Biosciences, San Jose, CA) and analyzed using FlowJo Software v10.0.7 (FlowJo, LLC, Ashland, OR, USA). Analysis of samples by flow cytometry was performed blindly.

Reyes-Uribe P., Adrianzen-Ruesta M.P., Deng Z., Echevarria-Vargas I., Mender I., Saheb S., Liu Q., Altieri D.C., Murphy M.E., Shay J.W., Lieberman P.M, & Villanueva J. (2018). Exploiting TERT dependency as a therapeutic strategy for NRAS-mutant melanoma. Oncogene, 37(30), 4058-4072.

+ Open protocol

+ Expand

Fluorescent Probe DNA Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed FP DNA binding assays using an Envision Xcite Multilabel Plate Reader (Perkin Elmer). 20 μl binding reactions were carried out in a buffer containing 20 mM Hepes, pH 7.5, 100 mM KCl, 2 mM MgCl2, 1 mM EDTA, 2 mM DTT, 1 mg ml⁻¹ BSA, 5% v/v glycerol and 75 nM polyT₅₀ competitor (IDT). The 18mer DNA probe (TTAGGGTTAGGGTTAGGG) was purchased with a 5′ 6-FAM label from IDT. The final probe concentration used was 2.5 nM, while the POT1–TPP1 protein concentration ranged from 0 to 100 nM or POT1C-TPP1(PBD) concentrations ranged from 0 to 5 μM. The reactions were incubated at room temperature for 30 min and pipetted in triplicate into a black 384 well optiplate (PerkinElmer). The reactions were excited with 480 nm light and the emissions were measured at 535 nm light. The milipolarization (mP) values were calculated by the Envision operating software (PerkinElmer). The data was fit and the binding constants were determined with a one-site binding, nonlinear regression model using PRISM 5.0 (GraphPad Software, San Diego California USA, www.graphpad.com).

Rice C., Shastrula P.K., Kossenkov A.V., Hills R., Baird D.M., Showe L.C., Doukov T., Janicki S, & Skordalakes E. (2017). Structural and functional analysis of the human POT1-TPP1 telomeric complex. Nature Communications, 8, 14928.

+ Open protocol

+ Expand

Measuring Fibroblast-Induced Oxidative Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

5000 melanoma cells were seeded in a 96 well plate in triplicate. The cells were then treated with conditioned media from young and aged fibroblasts as well as DMEM as control. Hydrogen peroxide was added at 1mM as control. After 72 hours, reactive oxygen species were measured using Cell Meter™ Fluorimetric Intracellular Total ROS Activity Assay Kit (#22901, AAT Bioquest, CA) according to the manufacturer’s protocol. The plates were measured using the PerkinElmer EnVision Xcite Multilabel plate reader using the filters for Ex/Em=520/605 nm. Alternatively, samples were imaged using PerkinElmer Operetta and the fluorescent signal was quantified using Harmony 3.0 software. The cell number was determined by Hoescht staining (Hoechst 33342, Invitrogen) and used to normalize the total fluorescence obtained from ROS staining.

Kaur A., Webster M.R., Marchbank K., Behera R., Ndoye A., Kugel CH I.I.I., Dang V.M., Appleton J., O’Connell M.P., Cheng P., Valiga A.A., Morissette R., McDonnell N.B., Ferrucci L., Kossenkov A.V., Meeth K., Tang H.Y., Yin X., Wood WH I.I.I., Lehrmann E., Becker K.G., Flaherty K.T., Frederick D.T., Wargo J.A., Cooper Z.A., Tetzlaff M.T., Hudgens C., Aird K.M., Zhang R., Xu X., Liu Q., Bartlett E., Karakousis G., Eroglu Z., Lo R.S., Chan M., Menzies A.M., Long G.V., Johnson D.B., Sosman J., Schilling B., Schadendorf D., Speicher D.W., Bosenberg M., Ribas A, & Weeraratna A.T. (2016). sFRP2 in the aged microenvironment drives melanoma metastasis and therapy resistance. Nature, 532(7598), 250-254.

+ Open protocol

+ Expand

High-throughput Screening of CART19 against NALM6

Check if the same lab product or an alternative is used in the 5 most similar protocols

We seeded CART19 and NALM6 (luciferase+) cells at a ratio of 0.08E:1T (i.e., 600 CART: 7000 NALM6) per well in 25 μl of growth medium (RPMI1640 + 10% FBS + 1% Pen-strep + 1% glutamine) of 384-well Corning 3570 microplate using a Multidrop™ Combi Reagent Dispenser (Thermo Scientific). Following cell seeding, drugs (50 nL) were transferred to assay plates using a 50 nL slotted pin tool (V&P Scientific) and a JANUS Automated Workstation (Perkin Elmer). Compounds/drugs were added to a final concentration of 1uM in 0.2% DMSO. Columns 1 and 23 were treated with 0.2% DMSO (negative control). Columns 2 and 24 were treated with 50nM Bortezomib (positive control). Cells were incubated for 48 hours at 37°C, 5% CO² in a humidified chamber. Assay plates were removed from the incubator for 1 hour to equilibrate to room temperature prior to adding 25 μL of 0.25X Britelite (PerkinElmer). Luminescence was measured on an EnVision Xcite Multilabel Plate Reader (PerkinElmer), using the ultrasensitive luminescence measurement technology.

Lee Y.G., Guruprasad P., Ghilardi G., Pajarillo R., Sauter C.T., Patel R., Ballard H.J., Hong S.J., Chun I., Yang N., Amelsberg K.V., Cummins K.D., Svoboda J., Gill S., Chong E.A., North K., Church S.E., Fraietta J.A., Chang W.J., Lacey S.F., Lu X.M., Zhang Y., Whig K., Schultz D.C., Cherry S., Gerson J., Schuster S.J., Porazzi P, & Ruella M. (2022). Modulation of BCL-2 in both T Cells and Tumor Cells to Enhance Chimeric Antigen Receptor T cell Immunotherapy against Cancer. Cancer discovery, 12(10), 2372-2391.

+ Open protocol

+ Expand

Fluorescence Polarization Assay for hCtc1(OB) Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fluorescence polarization (FP) assays were carried out in 20 μl binding reactions in a buffer containing 20 mM Hepes, pH 7.5, 100 mM KCl, 2 mM MgCl2, 1 mM ethylenediaminetetraacetic acid (EDTA), 2 mM DTT, 1 mg/ml bovine serum albumin (BSA), 5% v/v glycerol and 75 nM polyT₅₀ competitor (IDT). The 12mer DNA probe (TTAGGGTTAGGG) and 18mer DNA probe (TTAGGGTTAGGGTTAGGG) was purchased with a 5′ 6-FAM label from Integrated DNA Technologies. The final probe concentration used was 2.5 nM, while the hCtc1(OB) protein concentration ranged from 0 to 10 μM. Each reaction was performed in triplicate and incubated at room temperature for 30 min, pipetted into a black 384 well optiplate (PerkinElmer) and scanned with an Envision Xcite Multilabel Plate Reader (Perkin Elmer). Each well was excited with 480 nm light and the emissions were measured at 535 nm light. The Envision operating software (PerkinElmer) were used to calculate the milipolarization (mP) values.

Shastrula P.K., Rice C.T., Wang Z., Lieberman P.M, & Skordalakes E. (2017). Structural and functional analysis of an OB-fold in human Ctc1 implicated in telomere maintenance and bone marrow syndromes. Nucleic Acids Research, 46(2), 972-984.

+ Open protocol

+ Expand

Fluorescence Polarization Assay for hThumb Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed FP, hThumb – CR4/5 (CCCGCCTGGAGGCCGCGGTCCGCCGCGAAGAGTTGGGCTCTGTCAGCCGCGGG) and CR4/5 minus P6.1 binding reactions in 15 μl samples using an Envision Xcite Multilabel Plate Reader (Perkin Elmer). The binding reactions were carried out in a buffer containing 20 mM Tris.HCl pH 7.5, 100 mM KCl, 2 mM MgCl₂, 1 mM EDTA, 2 mM DTT, 1 mg/mL BSA, 5% v/v glycerol, and 75 nM cold tRNA competitor (Life technologies - Ambion yeast tRNA). The RNA probes were purchased with a 5′ 6-FAM label from IDT and Dharmacon. The final probe concentration used was 2.5 nM, while the hThumb protein concentration ranged from 0 to 5 μM. The reactions were incubated at room temperature for five minutes and pipetted in triplicate into a black 384 well optiplate (PerkinElmer). The reactions were excited with 480 nm light and the emissions were measured at 535 nm light. The milipolarization values were calculated by the Envision operating software (PerkinElmer). The data was fit and the binding constants were determined with a one-site binding, nonlinear regression model using PRISM 5.0 (GraphPad Software, San Diego California USA, www.graphpad.com).

Bryan C., Rice C., Hoffman H., Harkisheimer M., Sweeny M, & Skordalakes E. (2015). Structural Basis of Telomerase Inhibition by the Highly Specific BIBR1532. Structure (London, England : 1993), 23(10), 1934-1942.

+ Open protocol

+ Expand

Intracellular Inositol Phosphate Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the intracellular inositol phosphate assay, HaCaT cells were seeded in a 384-well OptiPlate (PerkinElmer, Inc.) at a density of 4 × 10⁴/well. After overnight incubation, the control group was treated with DMSO and the experimental group was treated with 50 and 100 µM sandalore for 24 h. The inositol phosphate concentration changes were detected using the IP-One Tb kit^® (62IPAPEC; CisBio Bioassays, Codolet, France) and EnVision Xcite Multilabel plate reader (PerkinElmer, Inc.) equipped with homogenous time-resolved fluorescence filters. The homogenous time-resolved fluorescence ratio was calculated by dividing the raw fluorescence values measured at 665 nm by the raw signals measured at 620 nm.

Kim J.S., Lee H.L., Jeong J.H., Yoon Y.E., Lee I.R., Kim J.M., Wu C, & Lee S.J. (2022). OR2AT4, an Ectopic Olfactory Receptor, Suppresses Oxidative Stress-Induced Senescence in Human Keratinocytes. Antioxidants, 11(11), 2180.

+ Open protocol

+ Expand

Fluorescent Protein-DNA Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

FP DNA-binding assays were performed with an Envision Xcite Multilabel Plate Reader (Perkin Elmer). Reactions were carried out in 20 mM Hepes, pH 7.5, 100 mM KCl, 2 mM MgCl₂, 1 mM EDTA, 2 mM DTT, 1 mg/ml BSA, 5% v/v glycerol, and 75 nM polyT50 competitor. The 12-24mer DNA probes (TTAGGG) were purchased with a 5′ 6-FAM label from Integrated DNA Technologies (IDT). Probe concentrations of 2.5 nM were used for all experiments. Reactions were incubated at room temperature for 30 min and performed in triplicate in light-proof optiplates (PerkinElmer). Probes were excited with 480 nm light and emissions measured at 535 nm. Milipolarization (mP) values were calculated through Envision software (PerkinElmer). All curves were fit with a one-site binding, nonlinear regression models using PRISM 5.0 (GraphPad Software, San Diego, CA, USA, www.graphpad.com).

Kelich J.M., Papaioannou H, & Skordalakes E. (2021). Pol α-primase dependent nuclear localization of the mammalian CST complex. Communications Biology, 4, 349.

+ Open protocol

+ Expand

Inhibitor-Induced Tumor Cell Viability Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumor cells (5 × 10³) were plated in complete medium in the presence/absence of DMSO control or PLX4720 or PD0325901 inhibitors. Cells were cultured for 72 h, at which time the medium received 1 × AlamarBlue (10% v/v; Life Technologies). Cells were allowed to reduce AlamarBlue for ~4 h and fluorescence was measured at 560/590 nm using a PerkinElmer Envision XciteMultilabel plate reader. Results are expressed as relative viability and are calculated as a proportion of fluorescence counts of tumor cells in the presence of drugs vs. tumor cells in the presence of vehicle control.

Somasundaram R., Zhang G., Fukunaga-Kalabis M., Perego M., Krepler C., Xu X., Wagner C., Hristova D., Zhang J., Tian T., Wei Z., Liu Q., Garg K., Griss J., Hards R., Maurer M., Hafner C., Mayerhöfer M., Karanikas G., Jalili A., Bauer-Pohl V., Weihsengruber F., Rappersberger K., Koller J., Lang R., Hudgens C., Chen G., Tetzlaff M., Wu L., Frederick D.T., Scolyer R.A., Long G.V., Damle M., Ellingsworth C., Grinman L., Choi H., Gavin B.J., Dunagin M., Raj A., Scholler N., Gross L., Beqiri M., Bennett K., Watson I., Schaider H., Davies M.A., Wargo J., Czerniecki B.J., Schuchter L., Herlyn D., Flaherty K., Herlyn M, & Wagner S.N. (2017). Tumor-associated B-cells induce tumor heterogeneity and therapy resistance. Nature Communications, 8, 607.

+ Open protocol

+ Expand

Cell Proliferation Assay with EBNA1 Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were plated at 5 × 10⁴ per well (in 200 μl) in a 96-well plate and treated with DMSO alone (0.4%), VK-1727 (0.25 or 2.5 μM), or VK-1850 (0.25 or 2.5 μM). At 24 and 48 hours after treatment, the plates were centrifuged at 1000 rpm for 5 min, and the medium was carefully aspirated and replaced with fresh medium containing DMSO alone or EBNA1 inhibitor at the appropriate concentration. After 72 hours, a BrdU cell proliferation assay was performed according to the manufacturer’s instructions (CytoSelect BrdU Cell Proliferation ELISA Kit, Cell Biolabs Inc.). Briefly, 10 μl of a 10× BrdU solution (100 μM BrdU) was added to each well, and plates were incubated at 37°C. Three hours later, cells were centrifuged at 1000 rpm for 5 min, washed thrice with 100 μl of phosphate-buffered saline (PBS), and treated with fix/denature solution. Cells were subsequently incubated with 100 μl of anti-BrdU antibody for 1 hour. Cells were washed thrice in 1× wash buffer, and after incubation with a secondary HRP-conjugated antibody, a substrate solution was applied. Plates were read on a PerkinElmer EnVision XCite multilabel plate reader (absorbance, 450 nm).

Messick T.E., Smith G.R., Soldan S.S., McDonnell M.E., Deakyne J.S., Malecka K.A., Tolvinski L., van den Heuvel A.P., Gu B.W., Cassel J.A., Tran D.H., Wassermann B.R., Zhang Y., Velvadapu V., Zartler E.R., Busson P., Reitz A.B, & Lieberman P.M. (2019). Structure-based design of small-molecule inhibitors of EBNA1 DNA binding blocks Epstein-Barr virus latent infection and tumor growth. Science translational medicine, 11(482), eaau5612.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!