Log In Sign up
The largest database of trusted experimental protocols

Cdna synthesis kit

Manufactured by New England Biolabs
Visit Supplier
Sourced in United States

The cDNA Synthesis Kit is a laboratory tool designed for the efficient conversion of RNA into complementary DNA (cDNA). The kit provides the necessary reagents and protocols to perform this fundamental step in various molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop 2000, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Sybr green master mix, by Thermo Fisher Scientific (2 mentions) Mirna first strand cdna synthesis kit, by GeneCopoeia (1 mentions) Universal qpcr master mix, by New England Biolabs (1 mentions) Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions) Cfx96 real time thermocycler, by Bio-Rad (1 mentions) Viia7, by Thermo Fisher Scientific (1 mentions) Nucleospin rna isolation kit, by Macherey-Nagel (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 2, by Roche (1 mentions)

Close spelling variants of this product

M-MuLV first-strand cDNA synthesis kit M-MuLV cDNA Synthesis Kit ProtoScriptIV First Strand cDNA Synthesis kit NEB ProtoScript II First Strand cDNA Synthesis Kit PhotoScript® first strand cDNA synthesis kit ProtoScript Moloney murine leukemia virus (M-MuLV) first-strand cDNA synthesis kit Lunascript cDNA synthesis kit PhotoScript II First Strand cDNA Synthesis Kit ProtoScript(R) II First-Strand cDNA Synthesis Kit ProtoScript II First Strand cDNA Synthesis Kit

5 protocols using cdna synthesis kit

1

Quantifying miRNA and mRNA Levels by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cell or tissue samples were lysed using TRIzol reagent to obtain RNA. Subsequently, RNA was quantified using a NanoDrop2000 (Thermo Fisher Scientific, USA). Following the manufacturer’s protocol, RNA samples (1 μg) were assembled into cDNA using a cDNA Synthesis Kit (NEB, USA) or an miRNA First-Strand cDNA Synthesis Kit (GeneCopeia, USA). Next, cDNA was diluted and amplified by qPCR using a Universal qPCR Master Mix (SYBR) (NEB). The reaction was performed on a StepOne™ Real-Time PCR System (Applied Biosystems, USA). GAPDH and U6 were used to normalize the data. Finally, the Ct value was calculated using the 2−ΔΔCt approach [20 ]. Table 1 lists the primer information.

Real-time PCR primer sequences

Gene nameSequence
miR-582–3pForward 5’-GCACACATTGAAGAGGACAGAC3’Reverse 5’-AACGCTTCACGAATTTGCGT-3’
RRM2Forward 5’- CACGGAGCCGAAAACTAAAGC-3’Reverse 5’- TCTGCCTTCTTATACATCTGCCA-3’
GAPDHForward 5’-TCAACGACCACTTTGTCAAGCTCA-3’Reverse 5’-GCTGGTGGTCCAGGGGTCTTACT-3’
U6Forward 5’-CTCGCTTCGGCAGCACA-3’Reverse 5’-AACGCTTCACGAATTTGCGT-3’
Xu H, & Li B. (2022). MicroRNA-582-3p targeting ribonucleotide reductase regulatory subunit M2 inhibits the tumorigenesis of hepatocellular carcinoma by regulating the Wnt/β-catenin signaling pathway. Bioengineered, 13(5), 12876-12887.
+ Open protocol
+ Expand
2

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from fresh tissues and cultured cardiomyocytes using the TRIzol reagent purchased from Thermo Fisher. Two micrograms of RNA was subjected to synthesize the first-strand cDNA by using the cDNA synthesis kit from New England Biolabs. Next, the mRNA expressions of target genes were analyzed with SYBR Green II qRT-PCR kit from QIAGEN on IQ5 (BioRAD). The forward and reverse primers used for quantitative real-time PCR are shown in Table 1.
Gao W., Guo N., Zhao S., Chen Z., Zhang W., Yan F., Liao H, & Chi K. (2020). Carboxypeptidase A4 promotes cardiomyocyte hypertrophy through activating PI3K-AKT-mTOR signaling. Bioscience Reports, 40(5), BSR20200669.
+ Open protocol
+ Expand
3

Transcriptional Profiling of P. aeruginosa Biofilms

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 100 μL of P. aeruginosa pellet was collected from the SK plate and the LK medium for RNA extraction, respectively. The RNA was extracted using Trizol with BCP as a phase-separating agent, and cDNA was synthesized using a cDNA synthesis kit (New England BioLabs). qPCR was conducted in a CFX-96 real-time thermocycler (Bio-Rad) using SYBR green AzuraQuant Fast Green Fastmix (Azura). Primer sequences can be found in Table 1. Fold changes were calculated using a ΔCt method with 30S ribosomal protein S12 as a housekeeping gene. Each of the three biological replicates contained three technical replicates.

Quantitative PCR primers used in this project.

GenePrimerSequenceSource
pilIForwardATCGTCGATGAGGTGTTCGGthis study
ReverseCGCCATGAATGAAGGGTTGCthis study
pilJForwardAACGCAGGCAATCTTTTCGCthis study
ReverseGTCATGGTTCGACTGGGTGTthis study
pelAForwardTGGAACAGCCAGGTAATGGACthis study
ReverseAAGCTGTCCAGGGTATCGAGthis study
pelBForwardTCTGCCGCTGACAAGCATCthis study
ReverseCGCTGGGCATGAATACCTCTthis study
pa1LForwardGATCTGCCACGATGCGTTTTthis study
ReverseACCCGGTATTGACCGGAATGthis study
lecBForwardGGAGTGTTCACCCTTCCCGthis study
ReverseCGACGGTTTCGTTGTTGACCthis study
rpsLForwardCTGCGTAAGGTATGCCGTGTthis study
ReverseGTTGTGACCTTCACCACCGAthis study
Zhang L., Gade V, & Kirienko N.V. (2023). Pathogen-induced dormancy in liquid limits gastrointestinal colonization of Caenorhabditis elegans. Virulence, 14(1), 2204004.
+ Open protocol
+ Expand
4

Transcriptional Profiling of p53 in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of HEPG2 cells was extracted by using NucleoSpin® RNA isolation kit (Macherey-Nagel, Germany) following the exposure of the cells to PC βCDC6 (1:16 vol/vol) for 24 h.
Extracted RNA was then converted to cDNA by harnessing cDNA synthesis kit (New England BioLabs, USA). Real-time polymerase chain reaction (RT-PCR) was executed using the cDNA samples to explore expression rates of TP53, and housekeeping gene GAPDH. RT-PCR assay was conducted utilizing SYBR green master mix (Thermo Fischer, USA) using Applied Biosystems ViiA™ 7 (USA) device. The relative changes at the transcriptional level of p53 gene in control and cells treated with PC βCDC6 were calculated using 2 -Ct , the comparative Ct method.
The primers for the assay were as follows: TP53 forward:
CACCATGAGCGCTGCCTCAGATAGC and reverse:
ACAGGCACAAACACGCACCTCAAA, GAPDH forward:
GTCGTATTGGGCGCCTGGTCAC and reverse: GCCAGCATCGCCCCACTTGATT.
Ercan A., Çelebier M., Oncul S., Varan G., Kocak E., Benito J.M, & Bilensoy E. (2021). Polycationic cyclodextrin nanoparticles induce apoptosis and affect antitumoral activity in HepG2 cell line: An evaluation at the molecular level. International journal of pharmaceutics, 598.
+ Open protocol
+ Expand
5

Quantification of Cytokine Genes in T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CD3+ T cells were co-cultured either with mDC only or mDC-MDA-MB-231 and then isolated by magnetic-activated cell sorting (MACS). Total RNA was extracted with Trizol (Invitrogen), and cDNA was synthesized using the cDNA Synthesis kit (NEB). A Light Cycler 480 II (Roche) was used to perform a SYBR Green-based qRT-PCR experiment. The house-keeping gene, GAPDH, was used for normalization. The qRT-PCR primers are as follows: human IL-1β, forward 5′-ACATCAGCACCTCTCAAGCA-3′ reverse 5′-AGTCCACATTCAGCACAGGA-3′; human IL-6, forward 5′-CTGGTCTTTTGGAGTTTGAGGT-3′ reverse 5′-GGAACTGGATCAGGACTTTTGT-3′; human IL-12, forward 5′-CCACAAAAATCCTCCCTTGA-3′ reverse 5′-AGGGACCTCGCTTTTTAGGA-3′; human GAPDH, forward 5′-TGACAACTTTGGTATCGTGGA-3′ reverse 5′-CAGTAGAGGCAGGGATGATGT-3′. Melting temperature was 60 °C.
Hwang H., Shin C., Park J., Kang E., Choi B., Han J.A., Do Y., Ryu S, & Cho Y.K. (2016). Human breast cancer-derived soluble factors facilitate CCL19-induced chemotaxis of human dendritic cells. Scientific Reports, 6, 30207.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!