Chromas 2

Genomic DNA from these specimens was isolated using the ZR Plant/Seed DNA MiniPrep Kit (Zymo Research Corporation, Irvine, CA, USA) and concentrations were measured using Nanodrop 2000 (Thermo Fisher Scientific Corporation, Waltham, MA, USA). A segment of 977 bp of the rbcL gene was amplified using PCR from the genomic DNA with RFrbcLf1 (5′GTCTAACTCTGTAGAAGAAC 3′) and RFrbcLr2 (5′GTCTAACTCTGTAGAAGAAC 3′) (Inqaba Biotechnica Industries (Pty), Muckleneuk, South Africa). PCR reactions were performed in 30 µL reactions for each sample. Each PCR tube contained 12.5 µL of the Promega Go Taq^® Green master mix (Promega Coporation, Madison, WI, USA), 2.5 µL of the forward primer (10 µM), 2.5 µL of the reverse primer (10 µM), 5 µL of the template DNA, and 7.5 µL of nuclease-free water. The reactions were carried out using the Bio-Rad My Cycler^® Thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). PCR reactions were performed with 1 cycle of 95 °C (initial denaturation) for 3 min; 40 cycles of 95 °C (denaturation) for 1 min; 50 °C (annealing temperature) for 30 s, 72 °C (extension) for 1 min, and 1 cycle of 72 °C (final extension) for 5 min.
Amplicons were sequenced with the PCR primers, analysed on a 3500 Genetic Analyzer (Thermo Fisher Scientific Corporation, Waltham, MA, USA), and assessed on Chromas 2.6.4 (Technelysium Pty Ltd., South Brisbane, Australia).

Genomic DNA was extracted from peripheral blood cells from control samples and from intestinal epithelial cells from colorectal tumors and paracancerous normal intestine tissue that is > 10 sm distant from the edge of cancer, respectively. MICA was genotyped by PCR sequencing of exons 2, 3, 4, and 5 using bidirectional Sanger sequencing methods (Zhou et al., 2014 (link)). Sequencing data were analyzed by Chromas 2.4.1 software (technelysium, Au). Allelic genotypes of MICA in each sample were obtained according to reference sequence of specific MICA alleles². For quality control in DNA typing, all sequencing processes were performed using robotic automation system to minimize sample mislabeling and misplacing. We also had blind duplicates in each sample plate.

Based on the sequence of Capra hircus species (GenBank Accession No. NC_030814.1), a pair of primers (F: 5′-TTTGGTTTTGCTGCTTTGCCT-3′; R: 5′-TCTTTCTTCTTCCCTCCACCCA-3′), which covered P27R, L61L, A85G, L50P, G40G, N112N, and D129D loci, were designed to amplify exon 3 of the goat GDF9 gene using Primer Premier software (Version 6.0). The PCR was carried out in a 25-μl reaction condition containing 1.0 μl of genomic DNA, 0.5 μl of forward and reverse primer separately, 12.5 μl of 2 × MIX (Tsingke, Xi'an, China), and 10.5 μl of ddH₂O. The PCR amplification protocol contained a pre-denaturation at 95°C for 5 min and denaturation at 94°C for 30 s, followed by 18 cycles of denaturation for 30 s at 95°C, annealing for 30 s at 68°C (with a decrease of 1°C per cycle), 30 cycles of elongation at 72°C for 30 s, and a final extension at 72°C for 10 min with subsequent cooling to 4°C (42 (link), 43 (link)). Subsequently, PCR products were genotyped by electrophoresis using 2.0% agarose gel, which was stained with ethidium bromide. The PCR product was then directly sequenced by the Tsingke Biotechnology Company (Xi'an, China) using Sanger sequencing technology. Finally, sequence alignment was conducted using BioXM 2.6 (College of Agriculture, Nanjing Agricultural University, Nanjing, China) and Chromas 2.4.1 (Technelysium Pty Ltd, South Brisbane, Queensland, Australia).

The single nucleotide polymorphisms of NLRP3 (rs3806265, rs7525979, rs35829419, rs10754558) and NLRC4 (rs12989936, rs212704, rs7562653, rs479333, rs385076) were selected from previous literature. Seven SNPs of NLRC5 (rs12598522, rs34531240, rs28438857, rs3995818, rs3995817, rs1684579, rs3751705) were selected based on information from the NCBI GenBank, dbSNP, and HapMap databases, with the minimum allele frequency set at 5% and r2 at 0.8. These SNPs were located within the coding region, 5′ untranslated region (UTR), or 3′UTR that may possibly influence protein synthesis and gene transcription. Peripheral blood (1 mL) was collected in an EDTA tube from each subject.
Genomic DNA was extracted from the whole blood using the QIAamp DNA Blood Mini Kit (Qiagen, Berlin, Germany) according to the manufacturer’s instructions and then stored in a −80 °C freezer. Primers were designed using Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA). PCR amplification was performed in Eppendorf PRO PCR System (Hamburg, Germany). All SNPs were genotyped by ABI Prism 377 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with technical support from the Shanghai Genesky Biotechnology Company (Shanghai, China). DNA sequences were read by Chromas 2.3 software (Technelysium Pty Ltd., Tewantin, Australia). Negative controls were included in each plate for accuracy.

The obtained chromatogram sequencing files were inspected and corrected using the software application Chromas 2.3 (Technelysium, Helensvale, Australia) and JalView (2.8).
The sequences obtained from our samples were aligned with GenBank sequences. The phylogenetic tree for each sequence was obtained by performing neighbor-joining analysis of the alignment of sequences with reference strains (accession numbers/country of origin) that were retrieved from GenBank. The studied strains were marked by the sign [■]. Meanwhile, the reference sequences were marked by the sign [▲].
The BLAST and FASTA programs of the National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/Blast.cgi) were used to search databases for similar nucleotide sequences [13 (link)]. Multiple sequence alignments of the nucleic acid were carried out using the ClustalW program. The statistical analysis was performed using SPSS version 20.0, χ² = chi-square test, and P values < 0.05 were considered significant.