Mircute serum plasma mirna isolation kit

miRNA was extracted from 200 μL of plasma using the miRcute serum/plasma miRNA isolation kit (Tiangen Biotech, Beijing, China) following the manufacturer's instructions. After washing miRNAs were eluted in 30 μL DEPC water. The RNA quantity was assessed by NanoDrop 2000C (Thermo Scientific). The cDNA was synthesized using the miRcute miRNA First-Strand cDNA Synthesis Kit (Tiangen Biotech, Beijing, China) on an ABI Veriti Thermal Cycler PCR System (Thermo Fisher Scientific, MA, USA).

The hub RNAs PART1, MIR4435-2 HG and LINC01980 were selected from the ceRNA network and subjected to RT-qPCR analysis to verify the reliability of the bioinformatics findings. The intracellular expression levels of PART1, MIR4435-2 HG and LINC01980 and their expression levels in serum were determined using RT-qPCR. Total cellular RNA was extracted using TrizolTM reagent (Takara, Dalian, Japan). Total serum RNA was extracted using miRcute Serum/Plasma miRNA isolation kit (DP160526, Tiangen Biotech, China). Total RNA was reversely transcribed into cDNA following the manufacturer’s instructions of MightyScript First Strand cDNA Synthesis Master Mix reagent kit (B639251, Sango Biotech, China). The 2X SG Fast qPCR Master Mix kit was employed, and spectrophotometer was used to determine the Ct value for each sample. GAPDH expression was measured and served as endogenous control. The measurement was repeated 3 times (n = 3) for each sample, and the data was analyzed using the 2^−ΔΔct method. The following primer sequences were used: (5ʹ3ʹ): MIR4435-2 HG-F: AGGAGGCGGAGCATGGAACTC, MIR4435-2HG-R: CAGGGGAAGCAAGTCTCACACATC, LINC01980-F: CATTGTAGGTGGGTGGGTGACTTC, LINC01980-R: CACTAACACAGGCTGAGCAGACTC, PART1-F: CCAGAGCCAGCCAATCACTTAGC, PART1-R: TGTTGTTCCAGTGCAGCCCTTTC.

All the GC specimens including tissues and blood, were obtained from patients who received surgical resection for GC at Shanghai General Hospital affiliated of Shanghai Jiaotong University. Before RNA extraction, all specimens were snap-frozen instantly and stored at −80^◦C. Blood samples (5 mL) were collected from all subjects in EDTA tubes and centrifuged at 3,000 rpm for 10 min at 4^◦C, then the plasma was cautiously collected and also keep it at −80^◦C until use. Total RNA extraction from tissues and plasma samples used TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and TRNzol A+ (TIANGEN, Beijing, China). miRNA used miRcute Serum/plasma miRNA isolation kit (TIANGEN, Beijing, China) according to the manufacturer’s protocols. After adding denaturing solution (Ambion) for normalization of the sample-to-sample variation, 1 ul of synthetic external control (1 umol/L; TIANGENN) was spiked into each sample.

Serum RNA was extracted from 200 μl volume using miRcute Serum/Plasma miRNA Isolation Kit (Tiangen, Beijing, China) in accordance with user manual. Each sample was diluted in 30 μl RNase-free water and stored at -80°C until use. Optical densities at 260/280 nm ranged between 1.45–1.93 (NanoDrop, Thermo Scientific), with RNA yields ranging between 129–393 ng.

The participants included in our research were divided into 2 groups: 12 healthy controls (Cont), 12 OSA patients. Total RNA was isolated from 600 μL of serum using the miRcute serum/plasma miRNA isolation kit (Tiangen: catalogue number DP503) and dissolved in 65 μL of RNAase-free water. Because of the lack of a stable endogenous serum miRNA, samples were spiked with a synthetic C. elegans mir-39 miRNA mimic (cel-mir-39: Catalogue number 219610) as a control to monitor changes in RNA recovery. Previous experimental studies have confirmed that celmir-39 is suitable for cyclic miRNA formulation specification. Ten microliters of total RNA was reverse transcribed to cDNA with the M-MLV reverse transcriptase (Promega). Specific miRNA quantification was performed by SYBR Green-based real-time PCR using a miScript SYBR Green PCR kit (QIAGEN; catalogue number 218073).

The potential miRNA biomarkers were tested by qRT-PCT by using an independent batch of samples, including 6 subjects for each group (Test, Con1 and Con2). All the subjects have signed informed consent. Total miRNA was extracted from the serum samples by a miRcute Serum/Plasma miRNA Isolation Kit (TIANGEN, Beijing, China) according to the manual. Single-stranded cDNA was obtained from the extracted miRNA, and qRT-PCR was performed to verify the expression of hsa-miR-448, hsa-miR-555 and hsa-miR-517b-3p through a miDETECT Tract^TM miRNA qRT-PCR Starter Kit (RiboBio, Guangzhou, China). The following primers were obtained from RiboBio Company (Guangzhou, China), hsa-miR-448: UUGCAUAUGUAGGAUGUCCCAU; hsa-miR-555: AGGGUAAGCUGAACCUCUGAU; hsa-miR-517b-3p: AUCGUGCAUCCCUUUAGAGUGU. Finally, the miRNA relative expression levels in serum were derived by normalizing to the level of the control cel-miR-39-3p using the 2^−ΔΔCT method.