Two complementary amine-modified 74bp oligonucleotides (IDT) with the sequences /5AmMC12/TGGTCAATACTAGGAGCAGAGATGGCAGGAGTCAGATGAACAGATAGTGGAGGCAGGGTCAGCGCGAGATCGTC (Strand 1) and /5AmMC12/ATGACGATCTCGCGCTGACCCTGCCTCCACTATCTGTTCATCTGACTCCTGCCATCTCTGCTCCTAGTATTGAC (Strand 2) were designed to minimize potential secondary structures and contain a 2nt overhang on each end, followed by a 12-carbon spacer terminating with an amine group. 25 µM Strand 1 and 2 were separately labeled with 1.25 mM BG-GLA N-Hydroxysuccinimide (NHS) (New England BioLabs, S9151S) and 1 mM alkyl chloride (AC) NHS (Promega, P6751), respectively, in a 50 mM HEPES pH 8.5 buffer containing 50% v/v DMSO. The reaction was allowed to proceed for 30 minutes at room temperature, after which the DNA was de-salted and exchanged into dynein motility buffer (DMB: 30 mM HEPES, 5 mM MgSO4, 1 mM EGTA, pH 7.0 with KOH) through five consecutive spins through 3,000 MWCO spin filters. DNA labeling was confirmed by gel electrophoresis using a 15% TBE-Urea gel, and the DNA concentration and purity were assessed by measuring A230, A260, and A280 absorbances.
Bg gla n hydroxysuccinimide nhs
Manufactured by New England Biolabs
BG-GLA N-Hydroxysuccinimide (NHS) is a chemical compound used in various biotechnology applications. It functions as an ester that can form covalent bonds with primary amine groups, enabling the attachment of biomolecules to surfaces or other molecules. The NHS group serves as an activated intermediate for the conjugation process.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using bg gla n hydroxysuccinimide nhs
1
Amine-Modified Oligonucleotide Labeling
2
Amine-Modified Oligonucleotide Labeling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two complementary amine-modified 74bp oligonucleotides (IDT) with the sequences /5AmMC12/TGGTCAATACTAGGAGCAGAGATGGCAGGAGTCAGATGAACAGATAGTGGAGGCAGGGTCAGCGCGAGATCGTC (Strand 1) and /5AmMC12/ATGACGATCTCGCGCTGACCCTGCCTCCACTATCTGTTCATCTGACTCCTGCCATCTCTGCTCCTAGTATTGAC (Strand 2) were designed to minimize potential secondary structures and contain a 2nt overhang on each end, followed by a 12-carbon spacer terminating with an amine group. 25 µM Strand 1 and 2 were separately labeled with 1.25 mM BG-GLA N-Hydroxysuccinimide (NHS) (New England BioLabs, S9151S) and 1 mM alkyl chloride (AC) NHS (Promega, P6751), respectively, in a 50 mM HEPES pH 8.5 buffer containing 50% v/v DMSO. The reaction was allowed to proceed for 30 minutes at room temperature, after which the DNA was de-salted and exchanged into dynein motility buffer (DMB: 30 mM HEPES, 5 mM MgSO4, 1 mM EGTA, pH 7.0 with KOH) through five consecutive spins through 3,000 MWCO spin filters. DNA labeling was confirmed by gel electrophoresis using a 15% TBE-Urea gel, and the DNA concentration and purity were assessed by measuring A230, A260, and A280 absorbances.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!