After the final EA stimulation session, animals were sacrificed and total RNA was isolated from the CC of brains using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and transcribed to complementary DNA (cDNA) using the RT2 First Strand Kit (Qiagen). cDNA was pooled from all experimental conditions, and PCR array analyses were performed according to manufacturer specifications. A diluted first-strand cDNA synthesis reaction mixture was used for real-time PCR using RT2 SYBR Green ROX FAST Mastermix (Qiagen) and the Rotor-Gene Q Real-Time PCR detection system (Qiagen). Eighty-four target genes were analyzed using the Mouse Growth Factors RT2 Profiler PCR array in Rotor-Disc 100 format (PAMM-041Z, Qiagen). Differences of gene expression were analyzed using Qiagen’s web-based RT2 Profiler PCR Array Data Analysis software, version 3.5 (http://pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php ). Data were normalized using multiple housekeeping genes and analyzed by comparing the 2−ΔCT of normalized data.
Rotor disc 100
Manufactured by Qiagen
Sourced in Germany, France, United Kingdom
The Rotor-Disc 100 is a centrifugal device designed for the automated processing of biological samples. It is capable of performing various steps in molecular biology workflows, such as nucleic acid extraction and purification. The Rotor-Disc 100 utilizes a specialized rotor to process samples in a controlled and consistent manner.
Automatically generated - may contain errors
Lab products found in correlation
Rt2 first strand kit, by Qiagen (2 mentions)
Rt2 sybr green rox fast mastermix, by Qiagen (1 mentions)
Rotor gene q real time pcr detection system, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Qiagility instrument, by Qiagen (1 mentions)
Rotor gene q real time pcr cycler, by Qiagen (1 mentions)
Custom rt2 profiler pcr array, by Qiagen (1 mentions)
Rotor gene q system, by Qiagen (1 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Promega (1 mentions)
Taqman universal pcr kit, by Thermo Fisher Scientific (1 mentions)
Qiagility robot, by Qiagen (1 mentions)
Quantitec reverse transcription kit, by Qiagen (1 mentions)
5 protocols using rotor disc 100
1
Gene Expression Analysis of Growth Factors
2
Quantification of Cardiovascular miRNAs by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiRNA quantification was performed using reverse transcription real-time polymerase chain reaction (RT-qPCR). Briefly, cDNA was transcribed from the extracted RNA and then aliquoted into the Human Cardiovascular Disease miScript miRNA PCR Array (Qiagen, Hilden, Germany). This array contains primers for 84 miRNA sequences, an individual miRNA primer sequence per well, identified as exhibiting altered expression during cardiovascular disease. The selected miRNAs are listed in Fig. 3 . All cDNA steps and PCR setup were performed by the QIAgility instrument (Qiagen, Hilden, Germany) using an automated pipetting protocol. RT-qPCR was performed on the miRNA PCR array in the Rotor-Disc 100 format by the Rotor-Gene Q real-time PCR cycler (Qiagen, Hilden, Germany). Rotor-Gene PCR cycling was performed according to the manufacturer’s suggested protocol and conditions. Cycle threshold (Ct) represents the cycle number at which there is an exponential increase in miRNA fluorescence. Individual miRNAs were determined to be detected when Ct values were lower than 33, while miRNAs with a Ct value ≥ 33 were considered not detected. Only miRNAs detected in at least 50% of subjects were retained for analysis, resulting in 53 total miRNAs analyzed.![]()
The 84 miRNA sequences on the Human Cardiovascular Disease miScript miRNA PCR Array grouped by their functional domains.
3
Quantification of mRNA Levels for Muscle-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Tri-Reagent according to the manufacturer’s instructions. RNA quality was checked by agarose gel electrophoresis. RNA quantity was measured by determining the absorbencies at 260 and 280 nm. The level of mRNAs corresponding to genes of interest was measured by reverse transcription followed by RT-PCR using a Rotor-Gene Q system (Qiagen, France). One μg of total RNA was reverse-transcribed using a RT2 First Strand Kit (Qiagen, France).
In order to analyse a panel of genes related to biological pathways (cellular structure and function, apoptosis, proliferation, metabolism, muscle differentiation, Notch pathway and regulation of anabolism), a RT2 Profiler Custom PCR Array was used to simultaneously examine the mRNA levels of genes of interest, including four housekeeping genes, in Rotor-disc 100 format according to the manufacturer’s protocol (SuperArray Bioscience Corporation)
[50 (link), 51 (link)]. mRNA expression for each target gene in control and vitamin D depleted samples was normalized using expression of Tbp as a housekeeping gene and was relative to control group according to the 2-ΔΔCT method, as described previously
[52 (link)].
In order to analyse a panel of genes related to biological pathways (cellular structure and function, apoptosis, proliferation, metabolism, muscle differentiation, Notch pathway and regulation of anabolism), a RT2 Profiler Custom PCR Array was used to simultaneously examine the mRNA levels of genes of interest, including four housekeeping genes, in Rotor-disc 100 format according to the manufacturer’s protocol (SuperArray Bioscience Corporation)
[50 (link), 51 (link)]. mRNA expression for each target gene in control and vitamin D depleted samples was normalized using expression of Tbp as a housekeeping gene and was relative to control group according to the 2-ΔΔCT method, as described previously
[52 (link)].
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 50- to 100-mg tissue samples using 1 mL Tri-reagent according to the manufacturer’s protocol. Three micrograms of RNA was digested with 3 units DNAse 1 (Promega) in a 10-μL reaction at 37°C for 45 minutes. The reaction was terminated by addition of 1 μL RQI DNAse Stop solution (Promega) and incubation for 10 minutes at 65°C. Complementary DNA was produced from the DNAse-digested RNA using random hexamer primers and Revert Aid Reverse Transcriptase (Fermentas, Fisher Scientific, Loughborough, UK), according to the manufacturer’s instructions. Ten microliters of qPCR reactions using 1 μL 1:20 diluted cDNA and 200 nmol/L primers (EFhd2 forward: TCGACCTGATGGAGCTAAAACTCA, EFhd2 reverse: ACACGTTGATGGCCTGTACCTT; actin forward: CTCGCCTTTGCCGATCC, actin reverse: AACATGATCTGGGTCATCTTCTC; GAPDH forward: CAGTCAGCCGCATCTTCTTT, GAPDH reverse: CCCAATACGACCAAATCCGT) and Brilliant III SYBR green reaction mix (Agilent, Santa Clara, CA) were prepared using a QIAgility robot and run on a Rotor-Gene cycler using a rotor disc 100 (Qiagen, Manchester, UK). Data of 3 runs with samples run in duplicate were analyzed with the Rotor-Gene software based on the ΔΔ-Ct method, with both actin and GAPDH used as reference genes.
5
Quantitative PCR Analysis of HERV-H Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (100 ng) was DNAse-treated and reverse transcribed (QuantiTec Reverse Transcription Kit, Qiagen). Reverse-transcriptase-free reactions were carried out to verify the absence of contaminating genomic DNA using the TaqMan Gene Expression Assay Human 18S system Hs03003631-g1 and TaqMan Universal PCR kit (both Life Technologies). SYBR green experiments were set up using the Type-it HRM PCR kit in 15 μl final reaction volume with 0.3 μM primers and a 20-fold cDNA dilution. PCR amplifications were carried out in Rotor-disc 100 wrapped discs using a Qiagility robot (all Qiagen). The cDNA amplifications were performed as follows: a 5 min denaturation step at 95°C followed by 45 cycles (95°C for 10s, Tm for 30s, 72°C for 10s) and HRM analysis (from 65°C to 95°C, 0.1°C increments every 2s). All reactions were performed in duplicates. Expression of housekeeping genes G6PD, GAPDH and HPRT was monitored for normalization purposes in the same batch of experiments as the HERV-H targets.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!