Total RNA was obtained after 9 h of fermentation using a Total RNA Isolation Mini Kit (Agilent Technologies) according to the manufacturer’s protocol. The concentration and quality of RNA were determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE) and an Agilent 2100 Bioanalyzer (Agilent Technologies), respectively. cDNA was reverse transcribed and labeled with cyanine 3-CTP using a Low-Input Quick Amp Labeling Kit (Agilent Technologies) for hybridization to S. cerevisiae 4 × 44 k microarrays (Agilent Technologies). Hybridization was performed at 65 °C for 17 h. The arrays were scanned using an Agilent Single-Color DNA Microarray Scanner (Agilent Technologies). Gene expression levels were normalized per chip. Scan data were analyzed using GeneSpring GX ver. 11.5.1 software (Agilent Technologies). The experiment was performed in triplicate. The accession number of the microarray data was GSE73814.
Total rna isolation mini kit
Manufactured by Agilent Technologies
Sourced in United States
The Total RNA Isolation Mini Kit is a laboratory product designed to extract and purify total RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and isolate RNA molecules, including both small and large RNA species. The kit provides a standardized protocol and necessary reagents to facilitate the RNA extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Low input quick amp labeling kit, by Agilent Technologies (3 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions)
Iq sybr green supermix, by Bio-Rad (3 mentions)
Agilent single color dna microarray scanner, by Agilent Technologies (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
44k microarrays, by Agilent Technologies (1 mentions)
Bioanalyzer pico kit, by Agilent Technologies (1 mentions)
Revertra ace qpcr rt master mix kit, by Toyobo (1 mentions)
Thunderbrid sybr qpcr mix, by Toyobo (1 mentions)
Sybr green, by Bio-Rad (1 mentions)
Stratagene mx3000p, by Agilent Technologies (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Mulv reverse transcriptase, by New England Biolabs (1 mentions)
Nuclease free water, by New England Biolabs (1 mentions)
Omniscript reverse transcription kit, by Qiagen (1 mentions)
Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
Revertra ace qpcr rt mix, by Toyobo (1 mentions)
Mx3005p real time pcr system, by Agilent Technologies (1 mentions)
15 protocols using total rna isolation mini kit
1
Transcriptome Analysis of S. cerevisiae
2
Transcriptomic Profiling Using RNA-Seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transcriptomics 0.5 mL culture was transferred into reaction tubes and centrifuged at 11.000 × g for 2 min, and the pellet was frozen in liquid nitrogen. The total RNA of the cells was isolated using the Total RNA Isolation Mini Kit (Agilent, Santa Clara, CA). The integrity of the RNA was measured using the BioAnalyzer Pico-Kit (Agilent, Santa Clara, CA). RNA-sequencing was performed by the Max Planck-Genome-Centre Cologne, Germany (https://mpgc.mpipz.mpg.de/home/ ). The sequencing reads were analyzed and mapped using the CLC Software (QIAGEN, Venlo, NL). For normalization, gene expression was calculated as transcripts per kilobase million (TPMs). RNA was sampled four times at the first time point t0; and two samples were collected at the remaining time points. For the time points t13, t15, t19 and t24 one of the two replicates was excluded due to low quality of the sampled RNA. Transcriptomics metadata is accessible under the GEO number GSE131992.
3
Quantitative Real-Time PCR Assay for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Agilent Total RNA Isolation Mini kit to the manufacturer’s instructions. Total 500 ng of RNA was reverse transcribed into cDNA using ReverTra Ace qPCR RT Master Mix kit (FSQ-201; TOYOBO). The relative mRNA expression levels were determined using real-time quantitative PCR by THUNDERBRID SYBR qPCR Mix (QPS-201; TOYOBO). Relative mRNA expression levels were determined by the ddCt method. Beta-actin was used as reference internal standard. The qPCR primers were picked up from published papers (Plotkin et al., 2014 (link); Luo et al., 2017 (link); Jerónimo-Santos et al., 2015 (link); Kursan et al., 2017 (link)), the sequence described as follow: TrkB FL: 5′-AAGGAGCCTTCGGGAAAGTT-3′ (forward), 5′-GAAAGTCCTTGCGTGCATTG-3′ (reverse), TrkB T1: 5′-CACTGGATGGGTAGCTGAGATA-3′ (forward), 5′-TGCAGACATCCTCGGAGATT-3′ (reverse), KCC2: 5′-TGCCCAGAAGTCTATCCCTAC-3′ (forward), 5′-CACCAAGTTGCCATTCACAG-3′ (reverse), PARP1: 5′-TGGTTTCAAGTCCCTTGTCC-3′ (forward), 5′-TGCTGTCTATGGAGCTGTGG-3′ (reverse), KIF4: 5′-GAGCACACTAAAATGTCAGGAGG-3′ (forward), 5′-CTGTTTGCTGGCTACTTGGAG-3′ (reverse), Act: 5′-AGCCATGTACGTAGCCATCC-3′ (forward), 5′-CTCTCAGCTGTGGTGGTGAA-3′ (reverse).
4
Quantitative RT-PCR for Heart Tissue
5
Transcriptome analysis of microbial fermentation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained after 3, 6, 24, and 48 h of fermentation using a Total RNA Isolation Mini Kit (Agilent Technologies) according to the manufacturer's protocol. RNA concentration and quality were measured using a NanoDrop ND-1000 spectrophotometer (NanoDrop, Wilmington, DE) and an Agilent 2100 Bioanalyzer (Agilent Technologies), respectively. cDNA was reverse-transcribed and labeled with cyanine 3-CTP using a Low-Input Quick Amp Labeling Kit (Agilent Technologies) for hybridization in 8×15k microarrays designed by the author. Hybridization was performed at 65 °C for 17 h and the arrays were scanned using an Agilent Single-Color DNA Microarray Scanner (Agilent Technologies). Gene expression levels were normalized per chip. GeneSpring GX ver. 11.5.1 software (Agilent Technologies) was used to analyze the fold-change in expression data. Each biological sample subjected to microarray analysis was analyzed in triplicate.
6
Quantitative Analysis of Epithelial-Mesenchymal Transition Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from cells was extracted with a Total RNA isolation mini kit (Agilent). cDNA was prepared with transcriptor first strand cDNA synthesis kit (Roche) and PCR was carried out with iQ SYBR Green Supermix (Bio-Rad). Samples were run on the QIAGEN Rotor-Gene Q real-time cycler. GAPDH was used as an internal control. The following primers were used:
GAPDH:
GAPDH:
Forward CATGAGAAGTATGACAACAGCCT;
Reverse AGTCCTTCCACGATACCAAAGT.
Forward TGCCCAGAAAATGAAAAAGG;
Reverse GTGTATGTGGCAATGCGTTC.
Forward ACAGTGGCCACCTACAAAGG;
Reverse CCGAGATGGGGTTGATAATG.
Forward CAGTGGGAGACCTCGAGAAG;
Reverse TCCCTCGGAACATCAGAAAC.
Forward GAGAACTTTGCCGTTGAAGC;
Reverse GCTTCCTGTAGGTGGCAATC.
7
GAS5 Expression in Rheumatoid Arthritis Fibroblast-Like Synoviocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Agilent Technologies Total RNA Isolation Mini Kit (Agilent Technologies, Palo Alto, CA, U.S.A.) according to the manufacturer’s recommendations. To quantify the GAS5 expression in the TanIIA-treated RAFLS (RAFLS + Tan IIA), untreated RAFLS (RAFLS-Tan IIA), normal cells (controls) or those transfected with siRNAs (si-GAS5-1, -2, -3, or si-Scramble), real-time quantitative PCR was performed. The primers used in the present study were the following: GAS5 forward, 5′-CCCAAGGAAGGATGAG-3′ and reverse, 5′-ACCAGGAGCAGAACCA-3′; GAPDH forward, 5′-GAGTCAACGGATTTGGTCGT-3′ and reverse, 5′-TTGATTTTGGAGGGATCTC-3′. The expression level was normalized using U6 small nuclear RNA by the 2−ΔΔCt method.
8
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the total RNA isolation mini kit (Agilent Technologies Ltd.). All samples were treated with DNAse on the columns using RNase-free DNase I provided in the kit. cDNA was synthesized from 0.2-1 μg of total RNA using 200 U MuLV reverse transcriptase (New England Biolabs), 40 U RNase inhibitor (human placenta) (New England Biolabs), 0.5 mM dNTP, 25 μM oligo-dT primers, and 10× reverse transcriptase buffer (500 mM Tris–HCl pH 8.3, 750 mM KCl, 30 mM MgCl2, 100 mM DTT) (New England Biolabs) in a final reaction volume 20 μl with added nuclease-free water as required (Qiagen).
9
Total RNA Extraction and qPCR Analysis
10
Rat Lung RNA Extraction and IL-6 Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the right lungs of rats with the total RNA isolation Mini kit (Agilent technologies, France) and then eluted from silicate columns and reverse-transcribed using Omniscript Reverse Transcription kit (Qiagen, Courtaboeuf, France). Constitutively expressed β actin was selected as an internal housekeeping gene control in the comparative (2-∆∆Ct) Ct method for the relative quantification of IL-6 mRNA expression. IL-6 and β actin gene expressions were quantified by RT-PCR with TaqMan Gene Expression Assays β actin [Rn00667869_m1], IL-6 [Rn01410330_m1], and TaqMan Universal PCR Master Mix followed in an ABI Prism7000 Sequence Detection System (Applied Biosystems, Courtaboeuf, France).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!