The largest database of trusted experimental protocols

Sh nc

Manufactured by OriGene
Sourced in China

The Sh-NC is a laboratory product designed for use as a non-targeting control in RNA interference (RNAi) experiments. It provides a negative control to help researchers assess the specificity of their RNAi knockdown experiments.

Automatically generated - may contain errors

5 protocols using sh nc

1

Heme Oxygenase-1 Knockdown Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The sequences of HO-1 shRNA and negative control shRNA (shNC) obtained from OriGene Technologies were as follows: HO-1 shRNA, TCCTTAC ACTCAGCTTTCTGGTGGCGACA and shNC, TGACCA CCCTGACCTACGGCGTGCAGTGC. Each sequence was cloned into a retroviral silencing (pRS) vector. Cells stably expressing original pRS vector (mock), shNC or HO-1 shRNA were selected with 0.5 μg/ml puromycin (Invivogen).
+ Open protocol
+ Expand
2

Modulating G3BP1 and β-Catenin in Colon Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
To overexpress G3BP1, colon cancer cells were infected with the lentivirus vector (Vector-G3BP1; Shanghai GenePharma Co., Ltd.) using 5 µg/ml polybrene (Hanbio Biotechnology Co., Ltd.) with an MOI of 10, and the infected cells were incubated with G401 (100 µg/ml) for 14 days at 37°C to establish the stably infected cells.
To silence β-catenin expression, colon cancer cells were infected with the lentivirus vector [short hairpin RNA (sh)-β-catenin; OriGene Technologies, Inc.] and puromycin (100 µg/ml) was applied to select the stably infected cells at 37°C for 14 days.
To knockdown G3BP1 expression, colon cancer cells were transfected with the small interfering (si)RNAs targeting G3BP1 (si-G3BP1; OriGene Technologies, Inc.) using Lipofectamine® 2000 reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The sequences were as follows: i) si-G3BP1-1, 5′-CCACACCAAGATTCGCCAT-3′; ii) si-G3BP1-2, 5′-GGAGATTCATGCAAACGTT-3′; iii) si-G3BP1-3: 5′-GGAGGAGTCTGAAGAAGAA-3′; and iv) si-NC: 5′-CCAAACCTTAGCGCACCAT-3′. Vector-NC, sh-NC and si-NC (OriGene Technologies, Inc.) were used as the negative controls for Vector-G3BP1, sh-β-catenin and si-G3BP1, respectively. After 48 h of transfection/infection, the cells were collected for subsequent experiments.
+ Open protocol
+ Expand
3

Silencing ERα and CaBP-9k with shRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNAs (shRNAs) used to silence ERα (sh-ERα; No. TL510613) or (sh-CaBP-9k, No. TL709169), and the negative control vectors (sh-NC) were purchased from OriGene (Beijing, China).
+ Open protocol
+ Expand
4

Silencing ACY1 and Overexpressing PTEN in NSCLC

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentivirus vector shRNA-ACY1 used to silence ACY1 expression in NSCLC cells and its negative control (sh-NC) were purchased from OriGene (Beijing, China; no. TL315053). The overexpressing lentivirus vectors used to upregulate PTEN (OE-PTEN) and ACY1 (OE-ACY1) were obtained from GenePharma (Shanghai, China). Firstly, the gene fragments were amplified, and the amplified fragments were connected to the lentivirus and packaged. To establish stable sh-ACY1- or OE-ACY1-transfected cell lines, H1975 cells were transfected with sh-ACY1 or OE-ACY1and then cultured with 8 µg/mL puromycin for 2 weeks, with the medium being changed every 2 days. Meanwhile, 100 µg/mL of G418 was used to select cells with OE-PTEN transfection.
+ Open protocol
+ Expand
5

Overexpression of KLK4 and miR-4739 modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The sh-LINC00504#1/2 and negative control (sh-NC) were bought from OriGene Technologies (USA). The overexpression of kallikrein related peptidase 4 (KLK4) was provided by OriGene Technologies. MicroRNA 4739 (miR-4739) inhibitor, miR-4739 mimics, and their corresponding negative controls (NC-inhibitor and NC-mimics) were obtained from GenePharma (Shanghai, China). The lipofectamine 2000 (Invitrogen, USA) was applied to achieve transfection. After incubated 4 h at 37 ℃, the fresh RPMI 1640 medium with 10% FBS was applied to replace the medium. After being incubated 48 h at 37℃, the cells were collected for further analysis.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!