Total RNA was prepared using RNeasy Lipid tissue kit (Qiagen, Hilden, Germany). After cDNA synthesis (Superscript-II Reverse Transcriptase, Invitrogen) expression of specific genes was analyzed by real-time-PCR using SYBR® Green (Invitrogen) and the ViiA™ 7 Dx Instrument (Applied Biosystems, Foster City, CA, USA). Specific primers were obtained from Sigma (Sequences are available upon request). The mRNA levels of genes were normalized to Hypoxanthine-Phosphoribosyl-Transferase (HPRT) using ΔCt and if applicable to control group by ΔΔCt method.
Viia7 dx instrument
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ViiA7 DX Instrument is a real-time PCR system designed for diagnostic use. It is capable of performing quantitative PCR (qPCR) analysis.
Automatically generated - may contain errors
Lab products found in correlation
Rna pcr kit, by Toyobo (2 mentions)
Rnaprep pure cell kit, by Tiangen Biotech (2 mentions)
Sybr green realtime pcr master mix, by Toyobo (2 mentions)
Rna pcr kit, by Takara Bio (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rneasy lipid tissue kit, by Qiagen (1 mentions)
Reverse transcription kit, by Accurate Biology (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Tb green premix ex taq kit, by Takara Bio (1 mentions)
Trizol reagent, by Vazyme (1 mentions)
7 protocols using viia7 dx instrument
1
Real-Time PCR Gene Expression Analysis
2
Quantification of Hepatic Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from 100 mg of liver tissue using TRIzol™ (CURATE Biotechnology, Carlsbad, CA, USA). In this case, cDNA was synthesized using a reverse transcription kit (ACCURATE BIOLOGY, Changsha, China), and gene expression was quantified using a SYBR Green Polymerase Chain Reaction (PCR) kit with an Applied Biosystems ViiA 7 Dx instrument. A reverse transcription PCR was performed to quantify the expression of Toll-like receptor 4 (TLR4), cluster of differentiation 14 (CD14), myeloid differentiation factor 88 (MyD88), tumor necrosis factor-α (TNFα), interleukin 10 (IL-10) and inducible nitric oxide synthase (iNOS) in the livers of mice in each group. All the primers were from BGI, and the primer sequences are shown in Table 1 . The internal control used was glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA.
3
Quantifying Gene Expression in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After transfection, total RNA was extracted from HeLa cells using the RNAprep Pure Cell Kit (TIANGEN, China) and then reverse-transcribed into cDNA using the RNA PCR Kit (TOYOBO, Japan) according to the manufacturer's instructions. Real-time PCR was conducted using a ViiA7 DX Instrument (Life Technologies, USA). The reactions were completed in a total volume of 10 µl containing 5 µl of SYBR Green Real-Time PCR Master Mix (TOYOBO, Japan), 2 µl of ddH2O, 1 µl of cDNA, and 1 µl of each primer. PCR amplification was performed using the following conditions: 10 s at 95°C and 45 cycles of 15 s at 95°C and 60 s at 60°C. The relative mRNA expression level was analyzed using the 2−ΔΔCT calculation method. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression level was used as an endogenous control. The forward primers and reverse primers were obtained from Sangon Biotech (Shanghai, China), and their respective sequences were as follows: ARHGEF10L: 5′AGTGCCAGGTGGTGTTCTTC3′ and 5′AAGAGGTCCCCGATCTTCTC3'; GAPDH: 5′CAGAACATCATCCCTGCCTCTAC3′ and 5′TTGAAGTCAGAGGAG ACCACCTG3'; HSPA6: 5′ ACTTTCACCACCTACTCGGA 3′ and 5′ CCCTCTCA CCCTCATACAC3'. All experiments were repeated at least three times.
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells collected from six-well plates by adding Trizol reagent (Vazyme Biotech, Nanjing, China), and quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, MA, USA). PrimeScript™ RT Master Mix Kit (RR036A, Takara Bio, Tokyo, Japan) was used for reverse transcription, and a TB Green™ Premix Ex Taq™ Kit (RR820A, Takara Bio, Tokyo, Japan) was used for PCR amplification. The PCR reactions were conducted in 20-μl reaction mixtures containing. PCR amplification was conducted as follows: pre-denaturation at 95 °C 30 s, then 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 34 s, and extension at 60 °C for 60 s. qRT-PCR was conducted using an Applied Biosystems ViiA 7 Dx instrument (Life Technologies Inc., Gaithersburg, MD, USA). Primer sequences were: RPS6 forward, 5′-TGTTACTCCACGTGTCCTGC-3′ and reverse, 5′- AAGTCTGCGTCTCTTCGCAA-3′; and β-actin forward, 5′-GTGGACATCCGCAAAGAC-3′ and reverse, 5′-AAAGGGTGTAACGCAACTA-3′. Gene expression levels were determined using the 2-ΔΔCt method, with β-actin as an internal reference.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the transfected MCF-7 cells or tumor tissues. First-strand cDNA was synthesized by reverse-transcription using an RNA PCR Kit (TaKaRa, Japan). Real-time PCR was conducted using a ViiA7 DX Instrument (Life Technologies, USA). Relative mRNA expression was calculated using the comparative threshold cycle (Ct) method. The target gene expression level was normalized to the expression level of GAPDH (glyceraldehyde-3-phosphate dehydrogenase). Forward primer and reverse primer sequences of the target genes were designed as follows: RCC2: 5′-AAGGAGCGCGTCAAACTTGAA-3′ and 5′-GCTTGCTGTTTAGGCACTTCTT-3′; GAPDH (glyceraldehyde-3-phosphate dehydrogenase): 5′-CAGAACATCATCCCTGCCTCTAC-3′ and 5′-TTGAAGTCAGAGAGGACCACCTG-3′; IGF1 (insulin-like growth factor 1): 5′-AGGATATTGGGCTTTACAACCTG-3′ and 5′-GAGGTAACAGAGGTCAGCATTTT-3′; SLIT2 (slit guidance ligand 2): 5′-GACTTCCAGAAGGTGCCGATGC-3′ and 5′-GTCATTGGTCCGTTGGTCACAGAG-3′; and TWIST1 (twist basic helix-loop-helix transcription factor 1): 5′-GACTTCCTCTACCAGGTCCTCCAG-3′ and 5′-TCCAGACCGAGAAGGCGTAGC-3′.
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the samples and then reverse-transcribed in a final volume of 10 µl using an RNA PCR Kit (Takara, Japan). Real-time PCR reactions were conducted in a ViiA7 DX Instrument (Life Technologies) according to the manufacturer’s protocol. The reactions were completed in a total volume of 10 µl, which contained the following: 1 µl of cDNA, 5 µl of SYBR Green Real-time PCR Master Mix (TOYOBO, Japan), 1 µl of each primer and 2 µl of H2O. PCR amplification cycles were performed under the following conditions: 30 s at 95°C followed by 40 cycles of 15 s each at 95°C and 34 s at 60°C. For each sample, two reactions were performed simultaneously. One reaction was performed to determine the mRNA level of the target gene, whereas the other reaction was performed to determine the level of GAPDH expression. PCR products were confirmed by melt curve analysis. Relative mRNA expression was calculated using the comparative threshold cycle (Ct) method. The relative target gene expression level was normalized to the GAPDH mRNA expression level. The primer sequences are presented in Supplementary Table 2 .
7
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the transfected cells using the RNAprep Pure Cell Kit (TIANGEN, China) and then reverse-transcribed using the RNA PCR Kit (TOYOBO, Japan). QRT-PCR was conducted using a ViiA7 DX Instrument (Life Technologies, USA) according to the manufacturer's protocol. Relative mRNA expression was calculated using the comparative threshold cycle (Ct) method, and the relative target gene expression level was normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression level. Respective forward and reverse primer sequences were as follows: ARHGEF10L: 5ʹ-AGTGCCAGGTGGTGT TCTTC-3ʹ and 5ʹ-AAGAGGTCCCCGATCTTCTC-3ʹ; GAPDH: 5ʹ-CAGAACATCATCCCTGCCTCTAC-3ʹ and 5ʹ-TTGAAGTCAGAGGAGACCACCTG-3ʹ; HSP A6: 5ʹ-ACTTTCACCACCTACTCGGA-3ʹ and 5ʹ-CCC TCTCACCCTCATACAC-3ʹ. All experiments were performed in triplicate. Forty-eight hours after the transfection, qRT-PCR was used to detect the RNA level.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!