Sybr green qpcr master mix low rox

Manufactured by Selleck Chemicals

Sourced in United States, China

The 2× SYBR Green qPCR Master Mix (Low ROX) is a pre-mixed solution containing all the necessary components for real-time quantitative PCR (qPCR) analysis using SYBR Green I as the fluorescent dye. The master mix includes a proprietary DNA polymerase, SYBR Green I, dNTPs, and a low concentration of ROX passive reference dye.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (5 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) All in one cdna synthesis supermix, by Selleck Chemicals (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Primescript master mix, by Takara Bio (2 mentions) Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions) Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Reverse transcription kit, by Promega (1 mentions) Hifair 2 1st strand cdna synthesis kit gdna digester plus, by Yeasen (1 mentions) Abi 7500, by Thermo Fisher Scientific (1 mentions) Hiscript 3 all in one rt supermix perfect for qpcr kit, by Vazyme (1 mentions)

Spelling variants of this product

SYBR Green (44 citations) SYBR Green Mix (10 citations) 2× SYBR Green qPCR Master Mix (low ROX) kit (7 citations)

9 protocols using sybr green qpcr master mix low rox

Quantitative Analysis of Chondrocyte Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primary chondrocytes cultured in vitro were added with 500 μL Trizol solution, and RNA was extracted and reverse transcribed according to the operating instructions of RNeasy Mini Kit (QIAGEN) and All-in-One cDNA Synthesis SuperMix (Bimake). Then, qPCR detection was performed with 2x SYBR Green qPCR Master Mix (Low ROX) (Bimake) reagent. Quantitative analysis was performed using β-actin as a control gene. Table 1 showed the primer sequences of target genes used in the current study.Table 1

Primer Sequences for Quantitative RT-PCR

Primer Name	Primer Sequence (5’→3’)
Aggrecan Forward	CAGTGCGATGCAGGCTGGCT
Aggrecan Reverse	CCTCCGGCACTCGTTGGCTG
TNFα Forward	CCCTCACACTCAGATCATCTTCT
TNFα Reverse	GCTACGACGTGGGCTACAG
Mmp-13 Forward	TTTGAGAACACGGGGAAGA
Mmp-13 Reverse	ACTTTGTTGCCAATTCCAGG
Col2 Forward	TGGTCCTCT GGGCATCTCAGGC
Col2 Reverse	GGTGAACCTGCTGTTGCCCTCA
β-actin Forward	GGAGATTACTGCCCTGGCTCCTA
β-actin Reverse	GACTCATCGTACTCCTGCTTGCTG

Zeng Q., Sun Q., Xu H., Chen J., Ling H., Ge Q., Zou K., Wang X., Jin H., Li J, & Jin M. (2023). Amygdalin Delays Cartilage Endplate Degeneration and Improves Intervertebral Disc Degeneration by Inhibiting NF-κB Signaling Pathway and Inflammatory Response. Journal of Inflammation Research, 16, 3455-3468.

+ Open protocol

+ Expand

Quantification of AMOTL2 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells was extracted by TRIzol (cat. no. 15596018; Thermo Fisher Scientific, Inc.) and reverse-transcribed using GoTaq^® Reverse Transcription system (cat. no. A3500; Promega Corporation), according to the manufacturer's instructions. Moreover, 2X SYBR Green qPCR Master mix (low ROX) was purchased from Bimake, and the reaction conditions used were according to the manufacturer's instructions (denaturation: 95°C for 15 sec; annealing/extension: 60°C for 30–60 sec; 40 cycles). Comparative quantification was performed using the 2^−ΔΔCq method with GAPDH as the endogenous control (25 (link)). All primers were synthesized by Beijing Tianyi Huiyuan Bioscience & Technology Inc. The primer sequences used were as follows: GAPDH forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′; AMOTL2 forward, 5′-TGGAGAAGACCATGCGGAAC-3′ and reverse, 5′-CTTCTCTTGCTCCTGCTGCT-3′.

Chen X., Lu Y., Guo G., Zhang Y., Sun Y., Guo L., Li R., Nan Y., Yang X., Dong J., Jin X, & Huang Q. (2021). AMOTL2-knockdown promotes the proliferation, migration and invasion of glioma by regulating β-catenin nuclear localization. Oncology Reports, 46(1), 139.

+ Open protocol

+ Expand

Quantitative Analysis of CTHRC1 Expression in Glioma

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from glioma tissues and cell lines using TRIzol reagent (Thermo Fisher Scientific, USA). Using a reverse transcription kit (Promega, USA), the RNA (3 μg) was reverse transcribed into cDNAs with a reverse transcription system of 20 μL. Quantitative polymerase chain reaction (qPCR) was conducted using 2 × SYBR Green qPCR Master Mix (Low ROX) (Cat #: B21702, Bimake, USA). The reaction mixture volume was 20 μL, including 10 μL of 2 × SYBR Green qPCR Master Mix (Low ROX), 6 μL of nuclease-free water, 0.2 μM of each primer and 2 μL of cDNA products. The PCR cycling conditions were as follows: 95 °C for 3 min, 95 °C for 15 s, and 60 °C for 40 s for 1 cycle and 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 1 s for 40 cycles followed by the melting curve stage. Relative gene expression was obtained using the 2^−ΔΔCT method. A t test was used for statistical analyses, and P < 0.05 was considered statistically significant.
The following primer sequences were used:
GAPDH
Forward: 5′-GGTGGTCTCCTCTGACTTCAACA-3′,
Reverse: 5′-GTTGCTGTAGCCAAATTCGTTGT-3’,
CTHRC1
Forward: 5′-GGACCAAGGAAGCCCTGAAAT-3’, and.
Reverse: 5’-AGCAACATCCACTAATCCAGCA-3’.
The relative standard curve method was used to analyze the data, which were normalized to GAPDH.

Peng D., Wei C., Zhang X., Li S., Liang H., Zheng X., Jiang S, & Han L. (2021). Pan-cancer analysis combined with experiments predicts CTHRC1 as a therapeutic target for human cancers. Cancer Cell International, 21, 566.

+ Open protocol

+ Expand

Quantification of Inflammatory Markers in Bone Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lumbar vertebral bone tissue stored in − 80 °C refrigerator was ground into powder form with liquid nitrogen, and then, a portion was added to 1 mL of Trizol solution. The primary chondrocytes cultured in vitro were added to 500μLTrizol solution. Bone tissue RNA was extracted and reverse transcribed according to the operating instructions of RNeasy Mini Kit (QIAGEN) and All-in-One cDNA Synthesis SuperMix (Bimake). The qPCR assay was then performed with 2 × SYBR Green qPCR Master Mix (Low ROX) (Bimake) reagent. And β-actin was used as a control gene for quantitative analysis. The target gene primer sequences were as follows:

Primer name	Primer sequences (5’ → 3’)
IL-1β Forward	GCAACTGTTCCTGAACTCAACT
IL-1β Reverse	ATCTTTTGGGGTCCGTCAACT
TNFα Forward	CCCTCACACTCAGATCATCTTCT
TNFα Reverse	GCTACGACGTGGGCTACAG
Mmp13 Forward	TTTGAGAACACGGGGAAGA
Mmp13 Reverse	ACTTTGTTGCCAATTCCAGG
Col2 Forward	TGGTCCTCT GGGCATCTCAGGC
Col2 Reverse	GGTGAACCTGCTGTTGCCCTCA
RELA Forward	AGGCTTCTGGGCCTTATGTG
RELA Reverse	TGCTTCTCTCGCCAGGAATAC
β-actin Forward	GGAGATTACTGCCCTGGCTCCTA
β-actin Reverse	GACTCATCGTACTCCTGCTTGCTG

Wang X., Zeng Q., Ge Q., Hu S., Jin H., Wang P.E, & Li J. (2024). Protective effects of Shensuitongzhi formula on intervertebral disc degeneration via downregulation of NF-κB signaling pathway and inflammatory response. Journal of Orthopaedic Surgery and Research, 19, 80.

+ Open protocol

+ Expand

Gene Expression Analysis of BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

After a culture period of 7 days, the total RNA from the BMSCs seeded on 6-well plates, at a density of 2*10^5 cells per well, was extracted using TRIzol reagent (Invitrogen, 15596018, USA) following the manufacturer’s instructions. The concentration of total RNA was measured using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, USA), and 1000 ng of the extracted RNA was reverse transcribed to cDNA using PrimeScript Master Mix (TaKaRa, RR036A, Japan). For the qRT-PCR reaction, 2× SYBR Green qPCR Master Mix (Low ROX) (Bimake, B21703, China) and Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) were used. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the quantitative control for normalization. The 2^−DDCt method was used to calculate the relative mRNA levels. The primers used in this study are listed in Table 1.

Jiao X., Sun X., Li W., Chu W., Zhang Y., Li Y., Wang Z., Zhou X., Ma J., Xu C., Dai K., Wang J, & Gan Y. (2022). 3D-Printed β-Tricalcium Phosphate Scaffolds Promote Osteogenic Differentiation of Bone Marrow-Deprived Mesenchymal Stem Cells in an N6-methyladenosine-Dependent Manner. International Journal of Bioprinting, 8(2), 544.

+ Open protocol

+ Expand

Fullerenol Modulates Inflammation in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For inflammation induction and fullerenol treatment, TCs were treated by 50 ng/mL IL-1β combined with aqueous fullerenol. Then, total RNA was extracted using TRIzol reagent (Thermo Scientific, United States). A NanoDrop 1,000 spectrophotometer (Thermo Scientific, United States) was used to evaluate RNA purity and quantification. 1,000 ng of the extracted RNA was reverse transcribed to cDNA using PrimeScript Master Mix (Takara, RR036A, Japan). The qRT-PCR reaction was performed with 2× SYBR Green qPCR Master Mix (Low ROX) (Bimake, B21703, China) and Applied Biosystems 7,500 Real-Time PCR System (Applied Biosystems, Foster City, CA, United States). The relative mRNA levels were calculated with 2^−ΔΔCT method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal control. The primers used in this study are listed in Table 1.

Jiao X., Wang Z., Li Y., Wang T., Xu C., Zhou X, & Gan Y. (2023). Fullerenol inhibits tendinopathy by alleviating inflammation. Frontiers in Bioengineering and Biotechnology, 11, 1171360.

+ Open protocol

+ Expand

Gene Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated from cell lines or lung tissues using Trizol reagent and then converted to cDNA by using the Hifair® II 1st Strand cDNA Synthesis Kit (gDNA digester plus) (Yeasen, Shanghai, China). Realtime qPCR was performed by using the 2× SYBR Green qPCR Master Mix (Low ROX) (Bimake, Shanghai, China) on the LightCycler® 96 Instrument according to the manufacturer’s guidelines. The relative levels of target genes were normalized to that of GAPDH (an internal control) to calculate the 2^−ΔΔCt value. The primers used in the study are listed in Supplementary Table 2.

Zhang C., Li Q., Xu Q., Dong W., Li C., Deng B., Gong J., Zhang L.Z, & Jin J. (2023). Pulmonary interleukin 1 beta/serum amyloid A3 axis promotes lung metastasis of hepatocellular carcinoma by facilitating the pre-metastatic niche formation. Journal of Experimental & Clinical Cancer Research : CR, 42, 166.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative real‐time PCR was performed using 2×SYBR Green qPCR Master Mix (Low ROX) (Bimake, USA) with an ABI Prism System (Applied Biosystems, Carlsbad, CA). All qRT‐PCRs were performed in triplicate, and the final volume of the reaction was 10 µL. Relative mRNA levels were calculated by the 2−ΔΔCt method with L19 as an internal control. Primer sequences are listed in Table S6 (Supporting Information).

Cao Y., Qi J., Wang J., Chen L., Wang Y., Long Y., Li B., Lai J., Yao Y., Meng Y., Yu X., Chen X., Ng L.G., Li X., Lu Y., Cheng X., Cui W, & Sun Y. (2024). Injectable “Homing‐Like” Bioactive Short‐Fibers for Endometrial Repair and Efficient Live Births. Advanced Science, 11(20), 2306507.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Tissue RNA Purification Plus Kit Plus (YiShan Biotechnology, China). Total RNA (1 μg) was used to synthesize cDNA by reverse transcription using the HiScript III All-in-one RT SuperMix Perfect for qPCR Kit (Vazyme, China). Quantitative real-time PCR (qPCR) test was conducted with 2× SYBR Green qPCR Master Mix (Low ROX; Bimake, USA) using a real-time PCR Detection System (ABI 7500, Life Technologies, USA). The cycling conditions included a 10-min initial denaturation step at 95 °C followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C and 30 s at 72 °C. Target gene expression was normalized to that of the housekeeping gene GAPDH. Relative fold difference in expression was calculated using the 2^−ΔΔCt method after normalization to GAPDH expression. Primers (Genewiz and Sangon Biotech, China) are shown in Supplementary Data 1. Experiments and quantifications were performed by an independent researcher who was blinded to the group allocation and the stimulation conditions.

Zhou K., Wei W., Yang D., Zhang H., Yang W., Zhang Y., Nie Y., Hao M., Wang P., Ruan H., Zhang T., Wang S, & Liu Y. (2024). Dual electrical stimulation at spinal-muscular interface reconstructs spinal sensorimotor circuits after spinal cord injury. Nature Communications, 15, 619.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!