Collected buccal cells were stored at room temperature with desiccant capsules (Isohelix, Kent, U.K.). DNA was then isolated from the swabs by the Dartmouth Translational Research Laboratory using DDK-50 isolation kits (Isohelix, Kent, U.K.). Genotyping for the rs9939609 single-nucleotide polymorphism in FTO was implemented with real time PCR and Taqman chemistry using primers and the 7500 Fast Real-time instrument (both from Thermo Fisher Scientific, Waltham, MA, USA). The context sequence for the rs9939609 SNP genotyping Taqman Assay from Thermofisher is: [VIC/FAM] GGTTCCTTGCGACTGCTGTGAATTT[A/T]GTGATGCACTTGGATAGTCTCTGT. The extraction volume for each sample was 80 μl with a mean (SD) DNA concentration of 31.7 (24.6) ng/μl. All 200 samples were successfully genotyped for rs9939609. There was 100% genotyping consistency among the 10% of samples that were blindly replicated.
7500 fast real time instrument
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7500 Fast Real-Time instrument is a qPCR (quantitative Polymerase Chain Reaction) system designed for fast and accurate gene expression analysis. It features a compact design and supports a wide range of sample types and applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master, by Roche (3 mentions)
Sybr green qpcr mix kit, by Aidlab (2 mentions)
Taqman assay, by Thermo Fisher Scientific (1 mentions)
Fastking rt kit, by Tiangen Biotech (1 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (1 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
Sybr green qpcr master mixes, by Thermo Fisher Scientific (1 mentions)
Superscript first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
15 protocols using 7500 fast real time instrument
1
FTO Genotyping from Buccal Swabs
2
Genetic and Activity Influences on Weight
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In addition to age and sex, we incorporated all participants’ average physical activity as a covariate into adjusted models by computing a weighted average of time spent (in minutes) being active on weekdays and weekend days, as reported by participants’ caregivers in response to the question(s): “On an average weekday/weekend day, how much time does your child spend doing physical activity, such as running around, climbing, biking, dancing, swimming, playing sports, etc.?”
Importantly, we also controlled for each participant’s genotype status arising from the FTO rs9939609 single nucleotide polymorphism to account for the known influence of FTO rs9939609 on weight status and risk for obesity (Frayling et al., 2007 (link); Loos and Yeo, 2014 (link)). Specifically, buccal cell swabs were collected and stored at room temperature with desiccant capsules (Isohelix, Kent, United Kingdom). DNA was isolated using DDK-50 isolation kits (Isohelix). Genotyping for rs9939609 was conducted with real-time PCR and Taqman chemistry using the 7500 Fast Real-time instrument (primers and instrument from Thermo Fisher Scientific (Waltham, MA, United States). All samples were successfully genotyped and there was 100% genotyping consistency among the 10% blinded replicates.
Importantly, we also controlled for each participant’s genotype status arising from the FTO rs9939609 single nucleotide polymorphism to account for the known influence of FTO rs9939609 on weight status and risk for obesity (Frayling et al., 2007 (link); Loos and Yeo, 2014 (link)). Specifically, buccal cell swabs were collected and stored at room temperature with desiccant capsules (Isohelix, Kent, United Kingdom). DNA was isolated using DDK-50 isolation kits (Isohelix). Genotyping for rs9939609 was conducted with real-time PCR and Taqman chemistry using the 7500 Fast Real-time instrument (primers and instrument from Thermo Fisher Scientific (Waltham, MA, United States). All samples were successfully genotyped and there was 100% genotyping consistency among the 10% blinded replicates.
3
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze gene expression levels, qRT-PCR was carried out with a 2 × SYBR Green qPCR Mix Kit (Aidlab, China) in a 25 μl volume on a 7500 Fast Real-Time instrument (Thermo Fisher, Waltham, MA, United States) using the following cycling protocol: 3 min at 94°C followed by 40 cycles of 20 s at 94°C, 20 s at 55°C, and 30 s at 72°C (signal acquisition at 72°C). ZjActin was used as a reference gene (Bu et al., 2016 (link)). The 2–ΔΔCt method was used to calculate the relative gene expression levels (Livak and Schmittgen, 2001 (link)).
4
Buccal Swab DNA Genotyping Protocol
5
Buccal Swab DNA Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Buccal cell swabs were collected before lunch and stored at room temperature with desiccant capsules (Isohelix, Kent, U.K.). DNA was isolated using DDK-50 isolation kits (Isohelix, Kent, U.K.). Genotyping for rs9939609 was conducted with real-time PCR and Taqman chemistry using the 7500 Fast Real-time instrument (primers and instrument from Thermo Fisher Scientific (Waltham, USA)). All samples were successfully genotyped and there was 100% genotyping consistency among the 10% blinded replicates.
6
Quantitative RT-PCR Analysis of DEGs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from leaves of control and treatment groups as described above. After determining RNA concentration and integrity, first-strand cDNA was reverse transcribed using a FastKing RT kit (TIANGEN, China) according to the manufacturer’s instructions. Total 28 DEGs including at least one differentially expressed comparison were selected for qRT-PCR analysis. Primers in this experiment designed using Beacon Designer (version 7.7) were listed in Additional file 2 : Table S10. The real time PCR amplifications were carried out with 2 × SYBR® Green qPCR Mix Kit (Aidlab, China) in 25 μl volume on the 7500 Fast Real-Time instrument (Thermo Fisher, Singapore) using the following cycling protocol: 3 min at 94 °C, followed by 40 cycles for 20 s at 94 °C, 20 s at 55 °C, and 30 s at 72 °C (signal acquisition at 72 °C). The 2−ΔΔCt method was used to calculate DEGs relative expression level [114 (link)].
7
Quantitative Gene Expression Analysis in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression analysis by qPCR for Pitx1, Sca-1 (Ly6a), Tnfsf11, Tnfrsf11b, and Axin2 was performed using TaqMan gene expression probes for mice with Gapdh as an endogenous control (Pitx1 #Mm00440824_m1; Ly6a #Mm00726565_s1; Tnfsf11 #Mm00441906_m1; Tnfrsf11b #Mm00435454_m1; Axin2 #Mm00443610_m1; Gapdh #Mm99999915_g1). The TaqMan Fast Advanced mastermix was used by following the manufacturer’s instructions (Thermo Fisher Scientific). Analysis was performed using the 7500-Fast Real Time instrument (Thermo Fisher Scientific). The ΔΔCT method was used for qPCR data analysis.
8
Recombinant dsAAV1-CAG-IL-10 Vector Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant double-strand AAV vector plasmid pdsAAV-CBA-EGFP was a kind gift from Arun Srivastava (University of Florida College of Medicine). pdsAAV-CAG-EGFP was generated by replacing the chicken beta-actin (CBA) promoter region of pdsAAV-CBA-EGFP with the cytomegalovirus immediate-early enhancer/chicken β-actin hybrid (CAG) promoter region, as previously described.44 (link) Using the In-Fusion HD Cloning Kit (TakaRa Bio), the EGFP region of pdsAAV-CAG-EGFP was replaced with rat IL-10 to generate pdsAAV-CAG-IL-10: rat IL-10 driven by the CAG promoter. Rat IL-10 was PCR cloned from rat splenocyte cDNA, as previously described.24 (link) Recombinant dsAAV vectors (dsAAV1-CAG-IL-10) were generated from cultured serum-free medium using polyethylenimine-based triple transfections of HEK293 cells.45 (link) AAV vector titer was determined by real-time PCR using a 7500 Fast Real-Time Instrument (Applied Biosystems) with rat IL-10 gene primers: forward, 5′-TAAGCTCCAAGACAAAGGGTG-3′; and reverse, 5′-GTCCTCCAGTCCAGTAGATG-3′.
9
Quantitative Analysis of Beclin-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Life technologies Corporation) followed the manufacturer`s protocol. 500 ng total RNA was reverse‐transcribed into cDNA in a total reaction volume of 10 μL by High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, Massachusetts, United States). Quantitative real‐time PCR analysis was performed with 1 μL cDNA using SYBR Green PCR Master (Roche) in a 7500 Fast Real‐Time instrument (Applied Biosystems, Foster City, CA, United States). Gene expression was normalized to endogenous GAPDH mRNA. The primers sequences of Beclin‐1 and GAPDH are as following: Beclin‐1‐Forward primer (F): 5`‐GACAGTGAACAGTTACAGATGG‐3`, Beclin‐1‐Reverse primer (R): 5`‐TCAGCCTGGACCTTCTCG‐3`; GAPDH‐F: 5`‐CATGTTCGTCATGGGTGTGAA‐3`, GAPDH‐R:GGCATGGACTGTGGTCATGAG.
10
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with Trizol reagent (Invitrogen, MA, USA). mRNA was reverse transcribed into cDNA and RT-PCR for relative quantification of target gene expression was performed using SYBR Green qPCR Master-Mixes (Thermo Scientific, MA, USA) on a 7500 Fast Real-time instrument (Applied Biosystems, MA, USA) following the respective instructions. Following primers were used: MET sense: 5′-TCCTGCAGTCAATGCCTCTC-3′ and MET antisense: 5′-CACATATGGTCAGCCTTGTC-3′; JUN sense: 5′-GGAAACGACCTTCTATGACG-3′ and JUN antisense: 5′-CTGCTCATCTGTCACGTTCTT-3′; ACTB sense: 5′-GGATGCAGAAGGAGATCACTG-3′ and ACTB antisense: 5′-CGATCCACACGGAGTACTTG-3′. β-actin gene ACTB served as reference gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!