The full‐length P. aeruginosa PA7 pumA and its TIR domain (residues 1–136) were cloned into pET151/D‐Topo (Invitrogen)—which carries the T7 promoter, N‐terminal 6xHis and V5 tags, protease recognition site for tobacco etch virus (TEV) protease and ampicillin resistance gene. The following primers were used: 5′‐CACCATGGCGGTCTTCATTAGTTATTCC‐3′ and 5′‐TGATCGGCTCTGCCCTATGC‐3′ for pumA; the same forward primer and 5′‐CTAACGGGACTGATCAGGATTAGAG‐3′ for pumA TIR domain. BtpA was cloned in this same vector. The HA‐TIRAP and HA‐Myd88 vector was used as a template to clone TIRAP and Myd88, respectively, into pRSF‐MBP vector. This vector corresponds to pRSFDuet‐1 (Novagen) but modified to insert 6xHis‐MBP from pETM‐41 vector (EMBL) behind the cloning multiple site.
Pet151 d topo
Manufactured by Thermo Fisher Scientific
Sourced in United States
PET151/D-TOPO is a lab equipment product offered by Thermo Fisher Scientific. It is a topoisomerase-based cloning system designed for the efficient and directional cloning of PCR products. The product facilitates the direct insertion of Taq polymerase-amplified DNA fragments into a plasmid vector without the need for restriction enzymes or ligase.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Endofree plasmid purification kit, by Qiagen (1 mentions)
Carbenicillin, by Fujifilm (1 mentions)
Kanamycin, by Fujifilm (1 mentions)
Bl21 star, by Thermo Fisher Scientific (1 mentions)
Actev protease, by Thermo Fisher Scientific (1 mentions)
Phusion dna polymerase, by Thermo Fisher Scientific (1 mentions)
Isopropyl b d 1 thiogalactopyranoside, by Thermo Fisher Scientific (1 mentions)
9 protocols using pet151 d topo
1
Cloning and expression of Pseudomonas aeruginosa PumA
2
DENV-2 NS2B Gene Cloning and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DENV-2 NS2B gene was cloned in the plasmid pET151/D-TOPO (Invitrogen). Briefly, total RNA was extracted from DENV-2-infected C6/36 cells using the Trizol reagent (Gibco, USA), according to the manufacturer’s instructions. The NS2B sequence from DENV-2 (New Guinea) was amplified by reverse transcription-PCR, using the primer pair: 5′-ctaggatccatgagctggccacta-3′ (forward) and 5′-ccggaattctcaccgttgtttcttcac-3′ (reverse). The PCR product was ligated into the pET151/D-TOPO cloning vector in frame with cDNA encoding a V5 epitope and a 6× His tag (V5H6NS2B). Finally, the plasmid from the resultant colonies was purified the next day using an EndoFree Plasmid Purification Kit (Qiagen, Inc., Chatsworth, CA). Construction was verified by automated DNA sequencing.
3
Purification and Characterization of T/Tbx6 DBD Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DBD region of T and Tbx6 [T: amino acids (aa) 41-224; Tbx6: aa 90-277] were PCR amplified and cloned into the PET151/D-TOPO (Invitrogen) producing a Histidine-tagged fusion protein. Transformed bacterial cultures were auto-induced, lysed and His-tagged fusion proteins were purified using nickel affinity purification followed by TEV protease digestion and a second round of nickel affinity purification to remove the Histidine tag. The protein was then further purified via anion exchange and size exclusion chromatography. Limited trypsin proteolysis revealed that >90% of isolated, purified proteins were correctly folded.
4
Bacterial Expression of Trypanosome Alternative Oxidase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TgMQO gene (DQ457183), lacking the mitochondrial targeting signal (MTS; Δ1-37 residues), was codon optimized for expression in E. coli and cloned into pET151-D-TOPO (Invitrogen, Carlsbad, CA, USA) to generate pET151/TgMQO, according to the manufacturer’s protocol.
The gene coding for TAO was amplified from pET101/NHis6SUMO-ΔMTS-TAO [92 (link)] and cloned into pACYC-Duet (pACYC-TAO). After the sequence was confirmed, this plasmid was used to transform FN102(DE3), a heme-deficient strain unable to re-oxidize ubiquinol unless 5-aminolevulinic acid (ALA) is provided or TAO is expressed [68 (link)]. The resultant strain, FN102(DE3)TAO, was used as the expression host and transformed with pET151/TgMQO. The final strain, named FN102(DE3)TAO/TgMQO, was selected on Luria-Bertani (LB) agar plates supplemented with 100 μg/mL carbenicillin (Wako, Kanagawa, Japan), 50 μg/mL kanamycin (Wako), 50 μg/mL chloramphenicol (TCI, Zwijndrecht, Belgium), and 50 μg/mL ALA.
The gene coding for TAO was amplified from pET101/NHis6SUMO-ΔMTS-TAO [92 (link)] and cloned into pACYC-Duet (pACYC-TAO). After the sequence was confirmed, this plasmid was used to transform FN102(DE3), a heme-deficient strain unable to re-oxidize ubiquinol unless 5-aminolevulinic acid (ALA) is provided or TAO is expressed [68 (link)]. The resultant strain, FN102(DE3)TAO, was used as the expression host and transformed with pET151/TgMQO. The final strain, named FN102(DE3)TAO/TgMQO, was selected on Luria-Bertani (LB) agar plates supplemented with 100 μg/mL carbenicillin (Wako, Kanagawa, Japan), 50 μg/mL kanamycin (Wako), 50 μg/mL chloramphenicol (TCI, Zwijndrecht, Belgium), and 50 μg/mL ALA.
5
Recombinant Talin Polypeptide Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Talin constructs were synthesized by PCR, using a mouse talin1 cDNA as a template, and cloned into pET-151/D-TOPO (Invitrogen). Constructs were expressed in Escherichia coli (DE3; BL21 Star; Thermo Fisher Scientific) cultured in lysogeny broth (LB). Recombinant His-tagged talin polypeptides were purified as described previously (Goult et al., 2009 (link)). Protein concentrations were determined using the respective extinction coefficients at 280 nm based on absorption coefficients calculated from the aromatic content according to ProtParam.
6
Purification of Recombinant Talin and Vinculin Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Talin constructs were synthesized by PCR using a mouse talin1 cDNA as template, and cloned into pET-151/D-TOPO (Invitrogen). Constructs were expressed in Escherichia coli BL21 Star (DE3) cultured in LB. Recombinant His-tagged talin polypeptides were purified by nickel-affinity chromatography following standard procedures63 (link). The His-tag was removed by cleavage with AcTEV protease (Invitrogen), and the protein was further purified by anion-exchange chromatography. Concentration was determined using extinction coefficients at 280 nm. Recombinant His- tagged chicken vinculin domain 1 (Vd1; residues 1–258) was expressed from a pET-15b plasmid and purified via nickel-affinity chromatography followed by anion-exchange chromatography, as described by20 (link).
7
Cloning and Mutagenesis of PRUNE1 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type PRUNE1 construct (amino acid residues 1–393) was cloned using TOPO technology into pET151/D-TOPO (Invitrogen), resulting in a construct with a His-tag fused to the N-terminus of PRUNE via a linker consisting of a TEV (tobacco etch virus) protease cleavage site. The mutations (D30N and R297W) were introduced via site-directed mutagenesis using mutagenic primers designed with a mismatch in the centre of the oligonucleotide, and sequencing verified. His-tagged wild-type and variant PRUNE1 pET151 constructs were then transformed into E. coli Rosetta 2 strain.
8
Cloning and Sequencing of BPSL1626 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The BPSL1626 gene (Uniprot code Q63UH6), coding for amino acid residues to 26–176 (minus the signal peptide) was amplified from B. pseudomallei strain K96423 genomic DNA (kindly provided by Prof. R. Titball, University of Exeter, UK) by PCR using the following primers: 1626-F:5′-CACCCAGACCGCGACGACCGGC–3′ and 1626-R:5′-CTACTTGTACGTCAGCGCGAATACCGC–3′ and Phusion DNA polymerase (Thermo Scientific), according to the manufacturer’s protocols. The gene was inserted into pET151/D-TOPO (Invitrogen), according to standard protocols. Successful cloning was confirmed by sequencing (Eurofins, Luxembourg).
9
Heterologous Expression of CtaA Periplasmic Domain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The two transmembrane helices of CtaA from P. fluorescens Pf0-1 (GenBank: ABA76168.1) have been predicted to comprise residues 7-33 and 278-301 by the TMHMM sever v.2.0 (http://www.cbs.dtu.dk/services/ TMHMM-2.0/) (26) (Figure 1). The sequence for the periplasmic sensing domain (CtaA peri , residues 34-277) was codon-optimized for expression in Escherichia coli and synthesized and ligated into the expression vector pET151/D-TOPO (Invitrogen) by GenScript. The protein construct had an N-terminal His 6 -tag separated from the CtaA peri coding sequence by the linker GKPIPNPLLGLDSTENLYFQ↓GIDPFT containing a Tobacco Etch Virus (TEV) protease cleavage site (underlined). The E. coli BL21 (DE3) cells (Novagen) were transformed with the expression vector, grown at 310 K in Luria Bertani broth supplemented with 50 mg/mL ampicillin to OD 600 of 0.6, and then protein expression was induced with 0.5 mM isopropyl-b-D-1thiogalactopyranoside (Thermo Scientific) for 3.5 h at 310 K. The cells were harvested by centrifugation at 6,000 g for 15 min at 277 K.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!