Phleomycin

Bloodstream form (BSF) parasites of T. b. rhodesiense IL1852 were grown in HMI-9 medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 10% serum plus (JRH Biosciences), and incubated at 37°C and 5% CO₂. Parasites were passed to fresh medium every 2 days. Antibiotic concentrations used for selection were 5 μg ml^-1 hygromycin B (Calbiochem), 1 μg ml^-1 G418 (Calbiochem) and 1.5 μg ml^-1 phleomycin (InvivoGen). For growth curves, parasites were seeded in medium at a concentration of 10⁴ parasites ml^-1 and counted daily using a Neubauer chamber on an inverted light microscope. On the third day, parasites were diluted to the initial concentration and counting continued. The cumulative cell number was calculated by multiplying by the dilution factor.
Cell lysates were extracted from 2×10⁶ parasites in the mid-log phase of growth. Parasites were centrifuged at 1500 g for 10 min, washed twice with phosphate-buffered saline (PBS), resuspended in 1× SDS-PAGE loading buffer and boiled for 5 min.

The vector for the U2 snRNA overexpression was generated using standard molecular cloning procedures. The full length U2 snRNA was amplified by PCR from the Pt1 cDNA using the following primers OE U2snRNAFw (XbaI site in italic): ctagTCTAGATTCGCCTTATTGGCTTTGAT and OE U2snRNARv (EcoRI site in italic): ccgGAATTCgagggaAAAGTGGGGGTACA. The fragment was cloned downstream a Phleomycin resistance cassette (Sh ble gene), and under the strong FcpF promoter, as described in [92 (link)].
The vector was introduced into wild-type P. tricornutum strain by microparticle bombardment using a BiolisticPDS-1000/He Particle Delivery System (Bio-Rad) [93 (link)] and transgenic lines were selected on 1% agar plates (50% f/2 medium) containing 100 μg/mL Phleomycin (Invivogen) in Normal Light (80 μmol photons m⁻² · s⁻¹). The presence of the construct in the transgenic lines was verified by checking the presence of the Shble gene by PCR with the primers Shble1fw and Shble1 rv. The presence of the full length U2 snRNA was verified by performing PCR using the primers Shble1 fw and snRNAU2 rv (Additional file 11: Table S4). On the selected transgenic lines, Northern blot analysis was performed, as described before. For the detection of the sRNAs, the membrane was hybridized overnight with oligonucleotides complementary to the U2-3′ sequence.

A single RNAi construct targeting all three TbCBPs in a common region of their DNA sequence was produced using plasmid pGL2084 as a backbone, and the resulting vector was transfected into T. brucei 2T1 BSF as previously described [45 (link)]. Primers to amplify the RNAi target sequence included AttB gateway flanks: Fw: GGGGACAAGTTTGTACAAAAAAGCAGGCTCGTTAATCAATGGAGCGGAT, Rev: GGGGACCACTTTGTACAAGAAAGCTGGGTGCTTTCCCCAACAACAAAGA. Genetically modified parasites were selected in HMI-11 complemented with 0.5 μg ml^-1 phleomycin (InvivoGen), and 2.5 μg ml^-1 hygromycin B (Calbiochem). RNAi induction was obtained with tetracycline (Sigma-Aldrich) at 1 μg ml^-1 24 h before experiments.

L. major Promastigotes of Friedlin (MHOM/JL/80/Friedlin) were grown in modified Eagle's medium (HOMEM, Sigma) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco) at 25°C, as previously described [31 (link), 32 (link)]. Suspensions of promastigotes were washed twice with PBS before being used either in vitro or in vivo. Leishmania major deficient in ISP2 and ISP3 (Δisp2/3) were generated as previously described by Eschenlauer et al. [27 (link)]. The following antibiotics were used at the indicated concentration for the selection of transfectants: 50 mg/mL hygromycin B (Roche), 25 mg/mL G418 (Invitrogen), 10 mg/mL phleomycin (InvivoGen), and 50 mg/mL puromycin dihydrochloride (Calbiochem).

Ustilago maydis strains used in the experiments include: FB1 (a1b1) and FB2 (a2b2), provided by Flora Banuett [19 (link)], and the solopathogenic haploid strain SG200 (a1 mfa2 bE1bW2); a FB1 derived strain engineered to grow filamentously and cause disease without a mating partner, obtained from Jörg Kämper (Karlsruhe Institute of Technology, Karlsruhe, Germany; [18 (link),24 ]). Budding cultures were grown on solid YEPS medium (1% w/v yeast extract, 2% w/v peptone, 2% w/v sucrose) containing agar for 3–4 days at 28 C; for SG200, solid medium was supplemented with 20 μg mL^-1 phleomycin (InvivoGen). Single colonies were inoculated into liquid YEPS medium and grown overnight (28 C, 250 rpm). Two hundred μL of overnight culture was inoculated into 200 mL of liquid YEPS medium and grown overnight (28 C, 250 rpm). Cultures were diluted to a final OD₆₀₀ of 1 using sterile dH₂O. For compatible haploids (FB1 x FB2) equal volumes of diluted culture were combined. For solopathogenic (SG200) injections, cultures were diluted to a final OD₆₀₀ of 1.

WinPac-RDpro-GFP cells were cultured in DMEM modified with high glucose, GlutaMAX and phenol red (Thermo Fisher Scientific) and supplemented with 10% volume/volume (v/v) FBS (Gibco [Thermo Fisher Scientific]) in a humidified incubator at 37°C and 5% CO₂. During cell expansion, blasticidin, hygromycin, phleomycin, and puromycin (InvivoGen, Inc.) were present at 10, 100, 30, and 1 μg mL⁻¹ working concentrations, respectively. However, these antibiotics were removed during LV production.
HEK 293T cells (ATCC) were cultured at 37°C and 5% CO₂ in DMEM modified with high glucose, GlutaMAX, and phenol red supplemented with 10% (v/v) FBS.