Before transfection, MSCs were replayed into six-well plates at a density of 2 × 105 cells/well and incubated overnight. For over-expression or inhibition of miR-34a, cells were transfected with 20 nM of miR-34a mimic or miR-34a inhibitor (both from GenePharma Co., Ltd., Shanghai, China), respectively. For SIRT1 inhibition, 100 nM Akt siRNA (GenePharma Co., Ltd., Shanghai, China) was transfected into cells. All miRNAs and siRNA were transfected into MSCs using a commercial transfection reagent (X-treme siRNA transfection reagent; Roche Applied Science, Penzberg, Germany) according to the manufacturer’s protocol. Forty-eight or 72 h after transfection, the cells were harvested for further analysis.
Mir 34a mimic
Manufactured by GenePharma
Sourced in China
MiR-34a mimics are short, synthetic RNA molecules designed to mimic the function of the natural miR-34a microRNA. MiR-34a is involved in the regulation of gene expression and plays a role in various cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (7 mentions)
Mir 34a inhibitor, by GenePharma (5 mentions)
Mir 34a mimic, by Thermo Fisher Scientific (2 mentions)
Mimic nc, by GenePharma (2 mentions)
Pcdna3.1 vector, by GenePharma (2 mentions)
X tremegene sirna transfection reagent, by Roche (2 mentions)
Mir 34a, by GenePharma (2 mentions)
Anti mir 34a, by GenePharma (2 mentions)
X treme sirna transfection reagent, by Roche (1 mentions)
Mouse monoclonal antibody against β actin, by Santa Cruz Biotechnology (1 mentions)
Oxamate, by Merck Group (1 mentions)
Dspe peg2000 fa, by Xi’an Ruixi (1 mentions)
Dipalmitoylphosphatidylcholine dppc, by Avanti Polar Lipids (1 mentions)
1 2 dipalmitoyl 3 trimethylammonium propane dotap, by Avanti Polar Lipids (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Mir nc, by GenePharma (1 mentions)
Lipofectamine 2000, by GenePharma (1 mentions)
Mir 383, by GenePharma (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Trizol reagent rnaiso plus, by Takara Bio (1 mentions)
17 protocols using mir 34a mimic
1
Transfection of MSCs with miR-34a and SIRT1 siRNA
2
Examining LDHA and Hexokinase 2 in miR-34a Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rabbit monoclonal lactate dehydrogenase-A (LDHA) antibody was ordered from Cell Signaling (#2012); mouse monoclonal antibody against Hexokinase 2 was purchased from Santa Cruz (sc-6521); mouse monoclonal antibody against β-actin was purchased from Santa Cruz Biotechnology (sc-47778). Oxamate was purchased from Sigma–Aldrich (St. Louis, MO, U.S.A.). MiR-34a mimic, miR-34a inhibitor, and their corresponding negative control were purchased from Shanghai GenePharma Co. Ltd. (Shanghai, China).
3
Preparation of Folate-Targeted miR-34a-Loaded Microbubbles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lipid-coated ultrasound contrast agents were prepared following the protocol described previously on preparing cationic MBs with some modifications (Yang et al., 2018 (link)). In brief, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folate(polyethylene glycol)] (DSPE-PEG2000-FA) (Xi’an Ruixi Biological Technology Co., Ltd.l) was utilized to create FA receptor-targeted MBs (FM) by mixing dipalmitoyl-phosphatidyl-choline (DPPC) (Avanti Polar Lipids, AL, USA) and 1,2-dipalmitoyl-3-trimethylammonium-propane (DOTAP) (Avanti Polar Lipids, AL, USA) in chloroform at a molar ratio of 2:9:1. After drying over 2 h in a 65 °C water bath, lipid films were generated at the bottom of glass vials. Then, the lipid films were hydrated at 65 °C with 800 mL 1% (w/w) glycerol-Dulbecco’s phosphate-buffered saline (DPBS, Gibco, USA) mixture. Subsequently, miR-34a-mimic (0 ∼ 30 μg) (Genepharma, Shanghai, China) was added to the lipid film complexes, and the mixture was degassed and refilled with perfluoropropane (C3F8). The miR-34a-mimic-FA-MBs (miR-34a-FM) were formed by intense mechanical shaking using an agitator for 45 s and were then centrifuged at 2000 g for 1 min to separate unattached mimic.
4
miR-34a Regulation of Notch1 in H9C2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
When H9C2 cells reached ∼80% confluence, they were transfected with 10 pmol miR-34a mimic (5′-UGGCAGUGUCUUAGCUGGUUGU-3′) (Shanghai GenePharma Co., Ltd.), miRs mimic negative control (miR-NC), 10 pmol miR-34a inhibitor (miR-inhibitor) (5′-ACCGUCACAGAAUCGACCAACA-3′) (Shanghai GenePharma Co, Ltd.), and 2 mg pcDNA-Notch1 (Taijin Saier Biotechnology) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. The concentration of FAM-miRNA was 10pmol/l, and the concentration of pcDNA-Notch1 was 2 mg/l. Transfection of miR-34a inhibitor was conducted 24 h before starvation treatment. We followed the methods of Jialin Pan, Yongjian Geng et al. 2014 [20 (link)].
5
miR-34a Mimic Transfection in SiHa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR-34a mimic (5′-UGGCAGUGUCUUAGCUGGUUGU-3′) and negative control (NC) mimic (5′-CGCGAUUGUAAACUUGCCGCG-3′) were obtained from GenePharma Co., Ltd. MACC1-AS1 and CDK6 expression vectors were established using the pcDNA3.1 vector (GenePharma Co., Ltd.). In order to perform transient transfections, SiHa cells were harvested when 80% confluence was reached and counted. Next, 2×106 cells in 2 ml medium (10% fetal bovine serum and 90% Eagle's minimum essential medium) were transferred to each well of a 6-well plate and were incubated with the transfection mixture, containing Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.) and 40 nM miR-34a mimic or 10 nM overexpression vector, for 5 h at 37°C. NC mimic or empty vector served as the NC groups. Following transfection, the cells were washed with fresh cell culture medium. Untransfected cells served as the normal control cells in all transfection experiments. All subsequent experiments were performed using cells collected at 24 h post-transfection.
6
Neuroprotection via miR-34a Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were first transfected with negative control miRNA, miR-34a mimic or miR-34a inhibitor (GenePharma, Shanghai, China) for 24 h using Lipofectamine RNAiMAX (Invitrogen, CA, USA) according to the manufacturer’s introductions. The cells were then treated with TDB (25 μM) under OGD condition for 4 h, whereupon OGD was terminated and the cells were further cultured for 24 h under normoxic conditions. The cells were then assayed by MTT assay, MMP assay and western blot.
7
miR-34a Overexpression in MHCC97H Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MHCC97H cells were transfected with 5 mg/ml miR-NC and 5 mg/ml miR-34a mimic (Shanghai GenePharma Co., Ltd., Shanghai, China) using Lipofectamine® 2000 as follows. The cells (4–5×104 cells/ml) were plated in a 6-well plate at 37°C for 24 h. Prior to transfection, the miRNA-Lipofectamine solution was prepared by mixing MEM separately with Lipofectamine or miRNA and then mixing the solutions together. Finally, the miRNA-Lipofectamine solution was added to each well, and the cells were incubated at 37°C for 24–72 h for subsequent analyses.
8
miR-Regulated Hepatocyte Lipid Accumulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary hepatocytes were isolated from male C57BL/6J mice and cultured as previously described (Sharma et al. 2011) (link). The miR34a, miR383 and miR146b mimics and inhibitors were synthesized by GenePharma Co. Ltd (Shanghai, China) with the following sequences: miR383 mimic (5′AGAUCAGAAGGUGACUGUGGCU3′), miR34a mimic (5′UGGCAGUGUCUUAGCUGGUUGU3′), miR 146b mimic (5′UGAGAACUGAAUUCCAUAGGCU3′), antimiR383 (5′AGCCACAGUCACCUUCUGAUCU3′, 2′Ome modification), antimiR34a ( 5
modification) and antimiR146b (5′AGCCUAUGGAAUUCAGUUCUCA3′, 2′Ome modification). Hepatocytes were transfected with 50 nM mimic or 100 nM inhibitor using XtremeGene siRNA transfection reagent (Roche Diagnostics). To induce lipid accumulation, primary mouse hepatocytes were incubated with or without 0.5 mM or 1 mM FFAs 234:2
(2:1 oleate/palmitate, Sigma), 6 h after miRs transfections. Hepatocytes were harvested at 24h post transfection for RNA extraction and 48h post transfection for protein extraction.
modification) and antimiR146b (5′AGCCUAUGGAAUUCAGUUCUCA3′, 2′Ome modification). Hepatocytes were transfected with 50 nM mimic or 100 nM inhibitor using XtremeGene siRNA transfection reagent (Roche Diagnostics). To induce lipid accumulation, primary mouse hepatocytes were incubated with or without 0.5 mM or 1 mM FFAs 234:2
(2:1 oleate/palmitate, Sigma), 6 h after miRs transfections. Hepatocytes were harvested at 24h post transfection for RNA extraction and 48h post transfection for protein extraction.
9
Plasmid Transfection Optimization in MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DMEM basic medium and OPTI-MEM were from HyClone (Logan, UT, U.S.A.). Fetal bovine serum, trypsin and penicillin–streptomycin solutions were obtained from Life Technologies (Carlsbad, CA, U.S.A.). The MDA-MB-231 cell line was from ATCC (Manassas, VA). The cell counting kit-8 (CCK-8) was from Dojindo (Kumamoto, Japan). The plasmid encoding enhanced green fluorescent protein (pEGFP) was kept in our laboratory. The PureLink™ HiPure Plasmid Miniprep kit was purchased from Invitrogen (Carlsbad, U.S.A.). The miR-34a mimics, cy5-labeled miR-34a mimic and miRNA negative control (miR-NC) were synthesized by Genepharma (Shanghai, China). TRIzol reagent (RNAiso Plus) was purchased from Takara (Dalian, China). RevertAid Reverse Transcriptase was purchased from Thermo Fisher (Runcorn, Cheshire, U.K.). Primers were synthesized by Sagon Biotech (Shanghai, China). The 2× SGExcel FastSYBR mixture and miRNA qPCR master mix (SYBR Green) was purchased from Sangon Biotech (Shanghai, China). The Notch1, Hes1 and GAPDH antibodies were from OmnimAbs (CA, U.S.A.). CMBs (Uphere™ Trans+) were obtained from Trust Bio Sonics (Taiwan, China).
10
Modulating Autophagy in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human colon epithelial cell line FHC obtained from the American Type Culture Collection (ATCC) was cultured in DMEM/F12 medium (GIBCO; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS) at 37°C in a humidified 5% CO2 atmosphere. The human CRC cell lines HCT116, HT29, SW620 and SW480 were purchased from the Cell Bank of the Chinese Academy of Sciences and were routinely cultured using RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS. The miR-34a mimics or miR-34a inhibitor purchased from Shanghai GenePharma Co., Ltd., were transfected into the CRC cells for 48 h using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) in indicated concentrations according to the supplier's instructions. Rapamycin (10 nM; Cell Signaling Technology, Inc.) and 3-methyladenine (3-MA; 5 mM; Sigma-Aldrich; Merck KGaA) were added to further activate or inhibit the flux of autophagy in CRC cells as previously described (12 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!