Qiaamp viral rna mini extraction kit

Manufactured by Qiagen

Sourced in Germany, United States

The QIAamp Viral RNA Mini extraction kit is a laboratory equipment designed to extract viral RNA from various sample types. It utilizes a silica-based membrane technology to efficiently capture and purify viral RNA, which can then be used for downstream analyses.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNA extraction kit (593 citations) QIAamp Mini Kit (164 citations) RNA mini kit (163 citations) QIAamp kit (104 citations) QIAamp Viral RNA (30 citations) QIAamp Viral RNA Mini (18 citations) Mini Kits (17 citations) QIAamp RNA kit (12 citations) QIAamp Viral kit (4 citations) QIAamp viral RNA extraction (2 citations)

41 protocols using qiaamp viral rna mini extraction kit

RT-PCR Testing for SARS-CoV-2 Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction for our RT-PCR testing was done using the QIAamp Viral RNA Mini extraction kit (QIAGEN GmbH, Hilden, Germany), following the manufacturer's instructions. RT-PCR set up was done with 10 μl of the RNA template in a 30 μl final reaction. The RealStar SARS-CoV-2 RT-PCR kit (altona Diagnostics GmbH, Germany), which targets the E and S genes of SARS-CoV-2, was used for RT-PCR testing on the Rotor-Gene 6000 cycler (QIAGEN GmbH, Hilden, Germany).
For the government laboratories, PCR testing was done using the available kit at the time and according to the manufacturer's instructions for the specific assay. RNA extraction was done using QIAamp Viral RNA Mini extraction kit (QIAGEN GmbH, Hilden, Germany) and the PCR was set up on a Light Cycler 480 or ABI7500 system. The 3 RT-PCR assays used were Aptima Panther Fusion SARS-CoV-2 assay (Hologic, Inc, San Diego, USA), which targets the ORF1ab gene; the Maccura SARS-CoV-2 assay (Maccura Biotechnology Co., Chengdu, P.R. China), which targets ORF1ab, E and N genes, and the Da An Gene SARS-C0V-2 assay (Daan Gene Co., Guangzhou, Guangdong, P.R. China), which targets the ORF1ab and N genes.

Tembo J., Egbe N.F., Maluzi K., Mulonga K., Chilufya M., Kapata N., Mukonka V., Simulundu E., Zumla A., Fwoloshi S., Mulenga L., Pallerla S.R., Velavan T.P, & Bates M. (2022). Evaluation of SARS-CoV-2 diagnostics and risk factors associated with SARS-CoV-2 infection in Zambia. International Journal of Infectious Diseases, 120, 150-157.

+ Open protocol

+ Expand

DENV2 Inhibition Assay in Huh-7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Huh-7 cells were plated in 24-well plates (in triplicate for each condition), infected at a MOI of 0.1, and treated with 100 nM CDDO-me or PU-WS13 and 50 µg/ml Heparin as an inhibitor for virus entry and 10 µM of 2’CMA as a viral polymerase inhibitor. Viral RNA was harvested using the QIAamp viral RNA extraction mini kit (Qiagen, USA) at 48 post-infection (hpi). Real-time quantitative reverse transcription and PCR (qRT-PCR) was performed and analyzed on a CFX96™ Real Time System (Bio-Rad (Portland, ME, USA) using DENV2 forward primer 5’ACATCTCAAGTGCAGGCTGA3’, and reverse primer 5’GTCTCCGAATGGAGGTTCTG3. Viral RNA levels were normalized to GAPDH RNA levels.

Rothan H.A., Zhong Y., Sanborn M.A., Teoh T.C., Ruan J., Yusof R., Hang J., Henderson M.J, & Fang S. (2019). Small molecule grp94 inhibitors with antiviral activity against Dengue and Zika virus. Antiviral research, 171, 104590.

+ Open protocol

+ Expand

Viral RNA Extraction and Reverse Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nucleic acids from specimens were extracted using the QIAamp viral RNA extraction mini kit (Qiagen GmbH, Hiden, Germany), according to the manufacturer’s recommended protocol. Reverse transcription was performed with the use of random hexamers and SuperScript first-strand (invitrogen), according to the manufacture’s instructions.

Parsania M., Poopak B., Pouriayevali M.H., Haghighi S., Amirkhani A, & Nateghian A. (2016). Detection of Human Metapneumovirus and Respiratory Syncytial Virus by Real-Time Polymerase Chain Reaction Among Hospitalized Young Children in Iran. Jundishapur Journal of Microbiology, 9(3), e32974.

+ Open protocol

+ Expand

Detection of MERS-CoV RNA in Lower Respiratory Tract

Check if the same lab product or an alternative is used in the 5 most similar protocols

To detect MERS-CoV RNA concentrations in the lower respiratory tract, viral RNA was isolated from 140 µL of lower respiratory specimens using the QIAamp Viral RNA extraction Mini kit (Qiagen) according to the manufacturer′s instructions. The RNA was dissolved in 60 µL of elution buffer and stored in separate aliquots at −80 °C. An Internal Control (IC) was included as a control for the procedure used for sample preparation (viral RNA purification). The extracted viral RNA was tested by real-time RT-PCR duplex assays targeting the upE and Orf1a regions of the MERS-CoV genome, using the RealStar® MERS-CoV RT-PCR Kit 1.0 (RT-PCR duplex assay). This system involves two independent assays, one targeting and quantifying a region upstream of the E gene (upE) and the other targeting the open reading frame regions 1a (orf1a) of the MERS-CoV genome. The analysis was performed using an ABI Prism® 7500 (Applied Biosystems).

Alosaimi B., Hamed M.E., Naeem A., Alsharef A.A., AlQahtani S.Y., AlDosari K.M., Alamri A.A., Al-Eisa K., Khojah T., Assiri A.M, & Enani M.A. (2019). MERS-CoV infection is associated with downregulation of genes encoding Th1 and Th2 cytokines/chemokines and elevated inflammatory innate immune response in the lower respiratory tract. Cytokine, 126, 154895.

+ Open protocol

+ Expand

RNA Extraction from FTA Cards

Check if the same lab product or an alternative is used in the 5 most similar protocols

The method used to extract RNA from the FTA cards consisted of a simple elution according to Muthukrishnan et al. [16 (link),17 (link)], briefly: six sections of 5 mm in diameter were removed from each FTA card using a disposable biopsy punch (Kai medical industries, Seki-shi, Japan). The six paper disks were divided into two 1.5 mL test tubes (three in each tube), 500 µL of minimum essential medium (MEM) was added, and the tubes were incubated overnight at +4 °C. For each sample the RNA was extracted from 140 µL of the overnight elution in MEM from one of the two duplicate tubes by using the QIAamp viral RNA extraction mini Kit (Qiagen, Hilden, Germany).

Abosrer F., Pezzoni G., Brocchi E., Castelli A., Baselli S., Grazioli S., Madani H., Kraim E., Dayhum A, & Eldaghayes I. (2022). FTA Cards as a Rapid Tool for Collection and Transport of Infective Samples: Experience with Foot-and-Mouth Disease Virus in Libya. Animals : an Open Access Journal from MDPI, 12(22), 3198.

+ Open protocol

+ Expand

Viral RNA Extraction and Nested PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nucleic acid was isolated using the QIAamp viral RNA extraction mini-kit (Qiagen) from 140 to 1000 µl aliquots of plasma. If the viral load was <10000 copies/ml, virus particles were pelleted by ultracentrifugation at 23 000×g for 1 h at 4°C. Equal amounts of extracted RNAs were reverse transcribed to cDNA. The cDNA synthesis was performed using the Superscript III First Strand Synthesis SuperMix (Invitrogen) with an initial incubation for 10 min at 25°C followed by 50 min incubation at 50°C and terminated by a final deactivation of the enzyme at 85°C for 5 min. The first round PCR was performed using the primer pairs A1 and A2, followed by a second-round PCR using the B1 and B2 primer pairs (Table S1). The resulting nested-PCR product of 1203 bp DNA fragment was analysed on agarose gel and extracted using the Qiagen's gel extraction kit. The concentration of gel purified DNAs were determined and equal amounts of PCR product corresponding to 10⁶ copies was then used for AS-PCR. The nested PCR was performed using the Expand High Fidelity Plus PCR System (Roche Diagnostics).

Ekici H., Amogne W., Aderaye G., Lindquist L., Sönnerborg A, & Abdurahman S. (2014). Minority Drug-Resistant HIV-1 Variants in Treatment Naïve East-African and Caucasian Patients Detected by Allele-Specific Real-Time PCR. PLoS ONE, 9(10), e111042.

+ Open protocol

+ Expand

Viral RNA Extraction and Purification from Swabs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted and purified from nasopharyngeal and pharyngeal swabs (140 ul) using the QIAamp Viral RNA extraction Mini kit (Qiagen, Hilden, Germany) following the manufacturer′s guidelines. Sterile RNase-free water was used instead of the specimen as a negative control. The concentration and purity of the extracted viral RNA were confirmed with NanoDrop 2000/2000c Spectrophotometer (Thermo Scientific, Waltham, MA, USA). Viral RNA purity was read at 260/280 nm, and concentrations were expressed in ng/μL. The purified viral RNA was eluted in 60 µL of elution buffer, frozen, and stored at −80 °C.

Awadalla M.E., Alkadi H., Alarjani M., Al-Anazi A.E., Ibrahim M.A., ALOhali T.A., Enani M., Alturaiki W, & Alosaimi B. (2023). Moderately Low Effectiveness of the Influenza Quadrivalent Vaccine: Potential Mismatch between Circulating Strains and Vaccine Strains. Vaccines, 11(6), 1050.

+ Open protocol

+ Expand

Viral RNA Extraction and Real-Time RT-PCR Detection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA was extracted from cultured viruses using a QIAamp Viral RNA Extraction Mini Kit (Qiagen, Valencia, CA) according to the manufacturer instructions. Viral RNA was detected by real-time reverse transcription-polymerase chain reaction (real-time RT-PCR) as previously described3 (link)13 (link). Briefly, a 185-bp amplicon was generated and detect by a TaqMan probe labeled with FAM and Blackhole Quencher. The amplification was carried out using an ABI 7500 real-time system (Life Technologies, NY) and the results analyzed with the instrument SDS software (version 2.0.1).

Zhu Z., Rivailler P., Abernathy E., Cui A., Zhang Y., Mao N., Xu S., Zhou S., Lei Y., Wang Y., Zheng H., He J., Chen Y., Li C., Bo F., Zhao C., Chen M., Lu P., Li F., Gu S., Gao H., Guo Y., Chen H., Feng D., Wang S., Tang X., Lei Y., Feng Y., Deng L., Gong T., Fan L., Xu W, & Icenogle J. (2015). Evolutionary analysis of rubella viruses in mainland China during 2010–2012: endemic circulation of genotype 1E and introductions of genotype 2B. Scientific Reports, 5, 7999.

+ Open protocol

+ Expand

SARS-CoV-2 Virus Isolation and Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Throat swabs specimens were inoculated into Vero/Slam cells as previously described [11 (link)]. Due to few cytopathic effects in the cell cultures, the culture supernatant was harvested directly after 7 days and used to inoculate fresh cells for up to two additional passages. RNA was extracted from the cultured viruses using the QIAamp Viral RNA Extraction Mini Kit (Qiagen, Beijing, China) following the manufacturer’s instructions. One-step real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to detect viral RNA using previously described methods [12 (link)]. The amplification was carried out with an ABI 7500 Real-Time System (Life Technologies, NY, USA) and data were analyzed with 7500 software (version 2.0.1).

Zhu Z., Pan G., Zhou S., Dai J., Chen X., Tang J., Chen S., Zheng Y., Song J, & Xu W. (2015). Imported Genotype 2B Rubella Virus Caused the 2012 Outbreak in Anqing City, China. PLoS ONE, 10(9), e0139173.

+ Open protocol

+ Expand

HEV RNA Detection in Bile and Liver

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from liver was performed manually as described in [9 (link)]. RNA extraction from bile was performed manually using the QIAamp Viral RNA extraction Mini kit (QIAGEN, Illkirch, France) according to the manufacturer’s instructions except that 200 μL of bile was used. HEV RNA detection in bile or liver samples was performed using real-time quantitative RT-PCR as described in previous literature [23 (link)].

Jori F., Laval M., Maestrini O., Casabianca F., Charrier F, & Pavio N. (2016). Assessment of Domestic Pigs, Wild Boars and Feral Hybrid Pigs as Reservoirs of Hepatitis E Virus in Corsica, France. Viruses, 8(8), 236.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!