Opticon 3

Manufactured by Bio-Rad

The Opticon 3 software is a real-time PCR data analysis tool designed for use with Bio-Rad's Opticon and CFX real-time PCR detection systems. It provides basic functionality for data analysis and interpretation of real-time PCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

Iq sybr green supermix, by Bio-Rad (4 mentions) Nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Rneasy mini kit, by Qiagen (3 mentions) Miniopticon real time pcr detection system, by Bio-Rad (1 mentions) Nanodrop software, by Thermo Fisher Scientific (1 mentions) Chromo4 thermal cycler, by Bio-Rad (1 mentions) Rnaquous 4 pcr kit, by Thermo Fisher Scientific (1 mentions) Oligo dt primer, by Thermo Fisher Scientific (1 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Chromo4 system, by Bio-Rad (1 mentions) Superscript 2, by Thermo Fisher Scientific (1 mentions) Tri reagent, by Merck Group (1 mentions)

Close spelling variants of this product

MJ Opticon Monitor software version 3.1 Opticon Monitor 3.1 analysis software Opticon-3 thermal cycler MJ Opticon Monitor Analysis software version 3.1 Opticon Monitor Software version 3.1 Opticon Monitor 3 Opticon Monitor Analysis Software version 3.4 Opticon Monitor v.3.1 software Opticon Monitor Analysis Software 3.1 tool

6 protocols using opticon 3

RNA Extraction and qRT-PCR Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

1 × 10⁸ cells were harvested at 800 ×g for 10 min at 4 °C and washed with ice-cold PBS and quick frozen in dry ice for 1 min. RNA was extracted using the RNeasy mini kit (Qiagen) according to the manufacturer's instructions and quantified using a ND-1000 spectrophotometer and Nanodrop software (Nanodrop Technologies). qRT-PCR was performed using iQ-SYBRGreen Supermix on a MiniOpticon Real-Time PCR Detection System (Bio-Rad). Quantification was done using Opticon3 software (Bio-Rad).

Murungi E., Barlow L.D., Venkatesh D., Adung'a V.O., Dacks J.B., Field M.C, & Christoffels A. (2014). A comparative analysis of trypanosomatid SNARE proteins. Parasitology International, 63(2), 341-348.

+ Open protocol

+ Expand

Quantifying Xenopus mpx Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Embryos were injected at the one- to two-cell stage with 25–50 pg of circular etsrp-XeX as previously described (Sumanas et al., 2008 (link)) in addition to scl MO. Batches of 20 injected and control uninjected embryos were frozen on dry ice at the tail bud stage. Total RNA was purified using the RNAquous-4PCR kit (Ambion). cDNA was synthesized using Superscript III reverse transcriptase and oligo-dT primer (Invitrogen). Real-time PCR was performed using Chromo4 thermal cycler (Bio-Rad) and iQ SYBR Green Supermix (Bio-Rad). The following PCR profile was used: 95°C 5 min; 95°C 1 min, 58°C 1 min, 72°C 1 min, detection at 82°C for 10 sec; steps 2 through 5 repeated 44 times. Relative cDNA amounts for mpx were calculated using the Opticon 3 software (Bio-Rad) and normalized to the expression of elongation factor 1 α (EF1α). Primers for measuring mpx expression span an intron-exon boundary to detect cDNA instead of genomic DNA. The following primer sequences were used. mpx-Forward: CTG CGG GAC CTT ACT AAT GAT GG; mpx-Reverse: CCT GGA TAT GGT CCA AGG TGT C; EF1α-Forward: TCA CCC TGG GAG TGA AAC AGC; EF1α-Reverse: ACT TGC AGG CGA TGT GAG CAG

Glenn N.O., Schumacher J.A., Kim H.J., Zhao E.J., Skerniskyte J, & Sumanas S. (2014). Distinct Regulation of the Anterior and Posterior myeloperoxidase Expression by Etv2 and Gata1 during Primitive Granulopoiesis in Zebrafish. Developmental biology, 393(1), 149-159.

+ Open protocol

+ Expand

Semi-quantitative rtPCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Semi-quantitative rtPCR was performed on a Chromo4 system with Opticon 3 software (BioRad). Fold change was calculated using the ΔΔCt model [26 ], normalized to actin (act-1). Primers are listed in S1 Table.

Wilson M.A., Iser W.B., Son T.G., Logie A., Cabral-Costa J.V., Mattson M.P, & Camandola S. (2017). skn-1 is required for interneuron sensory integration and foraging behavior in Caenorhabditis elegans. PLoS ONE, 12(5), e0176798.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

1 × 10⁸ cells were harvested at 800g for 10 minutes at 4°C and washed in ice-cold PBS and quick-frozen in dry ice for 1 minute. RNA was purified using an RNeasy minikit (Qiagen) according to the manufacturer’s instructions. The RNA concentration was quantified using an ND-1000 spectrophotometer (Nanodrop Technologies). qRT-PCR was performed using iQ-SYBR green Supermix on a MiniOpticon real-time PCR (RT-PCR) detection system (Bio-Rad), and quantified using OPTICON3 software (Bio-Rad) (52 (link)). The following primers were used: IGP48-RTF (CTGCAGGCTGCCAGCTCTG), IGP48-RTR (TTTAATCTCCCGTACGCAGG), IGP40-RTF (CTGCATGTGACTGCTGCT), IGP40-RTR (TGAAAGGGTATACAACTGACC), IGP34-RTF (ATTGCGTCTACCGATGGAAC), IGP34-RTR (TAGACTCCTCATCTGAATGC). Data were normalised against TERT (telomerase reverse transcriptase) (Brenndörfer et al., 2010) (TERT-RTF (GAGCGTGTGACTTCCGAAGG) and TERT-RTR (AGGAACTGTCACGGAGTTTGC)).

Allison H., O’Reilly A.J., Sternberg J, & Field M.C. (2014). An extensive endoplasmic reticulum-localised glycoprotein family in trypanosomatids. Microbial Cell, 1(10), 325-345.

+ Open protocol

+ Expand

Newt Gadd45-β Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from salamander tissue culture cells using Tri Reagent (Sigma) and random primed cDNA synthesised using Superscript II (Invitrogen). Gene expression was determined by quantitative real time PCR using the following primers: Newt Gadd45-β fwd (AGGGCACAGGAAAGAAGATG); Newt Gadd45-β rev (TCATTGTCGCAGCAGAAGG); Newt L-27 fwd (TACAACCACTTGATGCCA); Newt L-27 rev (CAGTCTTGTATCGTTCCTCA). Rt-PCR was carried out using iQ SYBR Green supermix (Bio-rad, Hercules, CA) on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 2 independent RNA preparations were analysed for each sample.

Yun M.H., Davaapil H, & Brockes J.P. (2015). Recurrent turnover of senescent cells during regeneration of a complex structure. eLife, 4, e05505.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

1 x 10⁸ cells were harvested at 800 g for 10 minutes at 4˚C and washed
in ice-cold PBS and quick-frozen in dry ice for 1 minute. RNA was purified using
an RNeasy minikit (Qiagen) according to the manufacturer’s instructions. The RNA
concentration was quantified using an ND-1000 spectrophotometer (Nanodrop
Technologies). qRT-PCR was performed using iQ-SYBR green Supermix on a
MiniOpticon real-time PCR (RT-PCR) detection system (Bio-Rad), and quantified
using OPTICON3 software (Bio-Rad) 52 (link). The
following primers were used: IGP48-RTF (CTGCAGGCTGCCAGCTCTG), IGP48-RTR
(TTTAATCTCCCGTACGCAGG), IGP40-RTF (CTGCATGTGACTGCTGCT), IGP40-RTR
(TGAAAGGGTATACAACTGACC), IGP34-RTF (ATTGCGTCTACCGATGGAAC), IGP34-RTR
(TAGACTCCTCATCTGAATGC). Data were normalised against TERT (telomerase reverse
transcriptase) (TERT-RTF (GAGCGTGTGACTTCCGAAGG) and TERT-RTR
(AGGAACTGTCACGGAGTTTGC).

Allison H., O’Reilly A.J., Sternberg J, & Field M.C. (2014). An extensive endoplasmic reticulum-localised glycoprotein family in trypanosomatids. Microbial Cell, 1(10), 325-345.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!