The largest database of trusted experimental protocols

Gelred nucleic acid

Manufactured by Biotium
Sourced in United States

GelRed Nucleic Acid Gel Stain is a fluorescent dye used to detect and visualize DNA and RNA in agarose gels. It exhibits strong fluorescence upon binding to nucleic acids and can be detected using standard UV or blue light transillumination equipment.

Automatically generated - may contain errors

10 protocols using gelred nucleic acid

1

Quantitative Pyrosequencing of RASSF1A and TIMP3 Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative pyrosequencing was performed with the PyroMark PCR Kit (Qiagen). Predesigned methylation assays were used to determine the methylation status of three CpG sites in the RASSF1A and six CpG islands in the tissue inhibitor of metalloproteinase‐3 (TIMP3) promoter (PyroMark CpG assay; Qiagen). The total volume of PCR reaction was 25 μl including 20 ng of bisulphite‐treated DNA. Thermal cycling protocol included steps as initial denaturation at 95°C for 15 min., followed by 45 cycles of amplification: 94°C for 30 sec., 56°C during 30 sec. and 72°C for 30 sec. and a final extension at 72°C for 10 min. The amplification products were confirmed by electrophoresis on 1.75% agarose gel, stained with GelRed Nucleic Acid Biotium Inc. (Fremont, CA, USA) and visualized on UV transilluminator. Obtained PCR products were analysed according to the manufacturer's instructions using the PyroMark Q96 ID System (Qiagen) with PyroMark Gold Q96 Reagents. Methylation data were evaluated with the instrument software (PyroMark Q96 software, version 2.5.8; Qiagen).
+ Open protocol
+ Expand
2

Extraction and Profiling of Pseudomonas aeruginosa

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA extraction was carried out using pure P. aeruginosacultures. A Wizard Genomic DNA purification kit (Promega, Wisconsin, USA) was
used for extraction according to the manufacturer's specifications. The presence
of the type 3 secretion systems (SST3) exoS and
exoU genes were detected by PCR using oligonucleotides
ExoS-F/R (1587 pb) and ExoU-F/R (761 pb) according to Ajayi et
al
.22 (link). Strains
PA01 and PA103 were assayed as positive controls for exoS and
exoU, respectively. The detection of integrases
int1-F/R (1202 pb), int2-F/R (973 pb) and
int3-F/R (239 pb) genes was conducted based on the protocol
described by Fonseca et al.23 (link) Amplified products were run in 2% agarose gels and
stained with GelRed Nucleic Acid (Biotium, California, USA) using TBE 1X buffer
for 30 min at 100 V cm. The size of the fragments was estimated using a
molecular marker (100 pb from Promega, and Gene Ruler 1Kb plus from Thermo
Fisher Scientific, Massachussets, USA). The resulting bands were visualized by
transillumination with ultraviolet light, and all gels were photographically
documented.
+ Open protocol
+ Expand
3

Detecting and Genotyping ESBL-Producing E. coli

Check if the same lab product or an alternative is used in the 5 most similar protocols
The presence of ESBLs was confirmed using the double-disc synergy test using CTX and ceftazidime with and without clavulanic acid, as recommended by the Clinical and Laboratory Standards Institute (CLSI 2014, Wayne, PA, USA). Cefoxitin (FOX)-resistant strains were classified as putative AmpC-producing E. coli.
Genetic detection and genotyping of β-lactamases were performed by PCR using boiled bacterial suspensions in Tris-EDTA buffer as the template. PCR analysis was performed with universal primers specific to the TEM, SHV, CTX-M-1, CTX-M-2, CTX-M-9, and CTX-M-8/25 groups, as previously described.12 (link) The PCR products were visualized by 2% agarose gel electrophoresis and stained with GelRed nucleic acid (Biotium, Hayward, CA, USA). The sequence analysis of CTX-M genes was performed as previously described.13 (link)
+ Open protocol
+ Expand
4

Bisulfite-Treated DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
One μg of genomic DNA was modified upon bisulfite treatment using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA, USA) following manufacturer instructions. Methylation-specific PCR (MSP) was performed with 1/10 bisulfite-converted DNA, the Phusion U Hot Start DNA Polymerase kit (F-555S, Thermo Fisher Scientific, Waltham, MA, USA), and specific methylated (M) and unmethylated (U) primers for the targeted regions of TRIM47, TFF3, DLG3, RASSF1A and GNMT. PCR products were electrophoresed and visualized in GelRed Nucleic Acid (Biotium, Fremont, CA, USA) stained gels (2% agarose) under UV light. The sequence of primers used in the study will be provided upon request.
+ Open protocol
+ Expand
5

PCR Amplification of ssDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR was performed using the GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA). The PCR mixture contained 5 μL of template ssDNA (~15 ng), 2.5 μL of each primer (10 μM), 25 μL of the PCR master mix solution (AmpliTaq Gold Fast PCR Master Mix, Applied Biosystems, Barcelona, Spain), and 15 μL of autoclaved water. The PCR conditions for ssDNA amplification were 95 °C for 5 min for denaturation, followed by 8 cycles of denaturation at 95 °C for 30 s, annealing at 56.3 °C for 30 s, and extension at 72 °C for 10 s, and a final extension of 72 °C for 5 min for the next round of STC-SELEX selection. After PCR, the reaction products were confirmed by gel electrophoresis using 2.0% agarose gel in 1× TAE (Tris-acetate-EDTA) buffer at 100 V for 40 min. The gels were stained with 0.5 mL of GelRed Nucleic Acid (Biotium, Inc., Hayward, CA, USA) in water and observed under UV light.
+ Open protocol
+ Expand
6

Genomic DNA Isolation from Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA (gDNA) from cell lines was isolated according to the protocol by GeneJET Genomic DNA Purification Kit (K0721; Thermo Fisher Scientific, Inc.). DNA samples were quantified by spectrophotometer BioSpec-nano (Shimadzu Scientific Instruments, MD, USA) and the integrity was analysed by horizontal 1.2% agarose gel electrophoresis stained with GelRed Nucleic Acid (Biotium, Inc., USA).
+ Open protocol
+ Expand
7

Methylation Analysis of miR-24-1 in NPC

Check if the same lab product or an alternative is used in the 5 most similar protocols
MSP was performed to analyze the methylation of the miR-24-1 promoter in NPC cells with or without irradiation. Briefly, DNA samples were extracted with a PureLink genomic DNA mini kit (Invitrogen), converted with an EpiTect bisulfite kit (Qiagen) following the manufacturer's protocol, and amplified by PCR using methylated and unmethylated specific primers for miR-24-1. By bisulfite conversion, non-methylated cytosines were transformed into uracils and methylated cytosines remained unconverted. PCR products were subsequently electrophoresed by 1.5% agarose gel stained with GelRed nucleic acid (Biotium) and finally exposed to ultraviolet radiation.
Two sets of miR-24-1 primers were designed with MethPrimer software (32 (link)): left methylated primer, ATTATGTGTTAGGAAAGGGAAAC; right methylated primer, CTATATACCGCCAACCCGTC; left unmethylated primer, ATTATGTGTTTAGGAAAGGGAAAT; and right unmethylated primer, ACAATCTATATACCACCAACCCATC.
+ Open protocol
+ Expand
8

Quantitative mRNA expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were treated with GAL, NF-κB inhibitor, AP-1 inhibitors, and LPS as indicated in individual experiments. The total RNAs were isolated with Trizol reagent (Invitrogen, CA, USA) and converted into corresponding cDNAs using SuperScript III reverse transcriptase and random hexamer primers (Thermo, Waltham, MA, USA). The mRNA expression was detected with specific primers as follows: COX-2 mRNA (NM_011198), sense: 5′-TGATCGAAGACTACGTGCAAC-3′, antisense: 5′-TCATCTCTCTGCTCTGGTCAA-3′; 5-LOX mRNA (NM_009662), sense: 5′-CCCCCGAAGCTCCCAGTGACC-3′, antisense: 5′-TCCCGGGCCTTAGTGTTGATA-3′; iNOS mRNA (NM_010927), sense: 5′-AAAGTGACCTGAAAGAGGAAAAGGA-3′, antisense: 5′-TTGGTGACTCTTAGGGTCATCTTGTA-3′; β-actin mRNA (NM_007393), sense: 5′-ATGGATGACGATATCGCTGC-3′, antisense: 5′-TTCTGACCCATTCCCACCATC-3′. PCR amplifications were performed according to the following program: denaturation at 94°C for 3 min, 25 cycles, (94°C for 30 sec, 57°C for 30 sec, and 72°C for 1 min) and extension at 72°C for 10 min. PCR products were analyzed by gel electrophoresis in 1.5% agarose containing GelRed nucleic acid (Biotium, Hayward, CA, USA) and visualized under UV light.
+ Open protocol
+ Expand
9

Multimodal Analysis of HCC1954 Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCL (MW 60 kDa), sodium cacodylate, sucrose, acetonitrile, propidium iodide (PI), Hoechst 33342 (HOE), hexafluoroisopropanol (HFIP), doxorubicin, and bovine serum albumin (BSA) were obtained from Sigma Aldrich (Steinheim, Germany), and ethanol from VWR Chemicals Prolab (Fontenay-sous-Bois, France). Bleomycin was from Abcam (Cambridge, UK).
The HCC1954 cell line was provided by ATTC (Guernsey, UK). Fetal bovine serum (FBS), culture media, and supplements were obtained from Corning (Mediatech Inc., Manassas, VA, USA). The PrestoBlue™ Cell Viability Reagent and secondary antibody goat anti-mouse Alexa 488 were purchased by Thermo Fisher Scientific (Eugene, OR, USA), whereas paraformaldehyde, Masson’s trichrome, and Alcian blue staining kits by BioOptica (Milan, Italy). The TriReagent and the qPCRBIO SyGreen 1-Step Go Lo-ROX were purchased from PCRBIOSYSTEMS (London, UK), and Gel Red Nucleic Acid staining from Biotium (Hayward, CA, USA). Anti-CD44 antibody was provided by AbD Serotech (Kidlington, UK), and Fluoroshield with DAPI was from Vector Laboratories (Peterborough, UK). Tissue-Tek® OCT was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
+ Open protocol
+ Expand
10

ISSR Amplification and Visualization

Check if the same lab product or an alternative is used in the 5 most similar protocols
The amplification reaction for analysis of ISSR (Inter Simple Sequence Repeat) was used following a method modified from Zietkiewicz et al. (1994) (link) Amplification products were submitted to electrophoresis in Agar gel at 1.2%, coloured with GelRed Nucleic Acid (Biotium). Amplified fragments were visualized in ultraviolet light and photographed with L-PIX Transilluminator Molecular Imaging (Loccus Biotecnologia).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!