The largest database of trusted experimental protocols

3 protocols using cd45.1 efluor 450

1

Multicolor Flow Cytometric Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Blood was washed in PBS, stained with live/dead fixable blue dead cell staining kit (Invitrogen), washed in PBS and blocked in 2% FBS-PBS / 0.02% sodium azide plus Fc-block (Anti-CD16/32 antibody 1:200, BD Biosciences). Surface antigens were detected by incubation for 30 min at 4°C with conjugated antibodies including CD45.1-eFluor 450 (eBioscience Cat# 48-0453-82, RRID:AB_1272189), CD45.2-FITC (BD Biosciences Cat# 553772, RRID:AB_395041), CD3e-APC (BD Biosciences Cat# 561826, RRID:AB_10896663), CD19-APC-H7 (BD Biosciences Cat# 560143, RRID:AB_1645234), CD11b-PE (BD Biosciences Cat# 562287, RRID:AB_11154216) and GR1-Alexa Fluor 700 (BioLegend Cat# 108422, RRID:AB_2137487). Following washing with 2% FBS-PBS 0.02% sodium azide, red cells were lysed and leukocytes fixed by incubating in lyse/fix solution (BD Biosciences). Cells were washed with PBS and analyzed on an LSR-II cytometer (Becton Dickenson). Data were processed using FlowJo Software (Tree Star).
+ Open protocol
+ Expand
2

Multiparametric flow cytometry analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Single-cell suspensions of BM and skin-infiltrating leukocytes were incubated at 4 °C for 20 min in staining buffer (1 × PBS with 0.1% bovine serum albumin and 0.1% sodium azide) containing the appropriate antibody mix. NOS2-AF488, CD45.1-eFluor 450, Ly6G-FITC, Ly6G-PE, Ly6G-PE.Cy7, CD11b-PE, CD11b-APC, F4/80-PE, CD115-APC, Ly6C-APC, CD45-PE, B220-PE, CD4-APC, CD8-APC, and CD105-APC antibodies were obtained from eBioscience. Lineage cocktail-APC, CD11c-APC.Cy7, α-BrdU-FITC and CD34-PE antibodies were purchased from BD Pharmingen (San Diego, CA, USA). Arginase-FITC antibody was purchased from R&D systems (Minneapolis, MN, USA). For the flow cytometric analysis of Lineage-positive cells, the cells were stained with biotinylated Lineage cocktail obtained from BD Pharmingen, then labeled with streptavidin-V450 (BD Pharmingen). Data were collected using a FACSCalibur or LSRII-Green (both BD Pharmingen) and were analyzed using the FlowJo software (Tree Star, Ashland, OR, USA).
+ Open protocol
+ Expand
3

Jedi Mice Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Jedi mice were genotyped by PCR genotyping using the following primers: TCRα-For: GAGGAGCCAGCAGAAGGT; TCRα-Rev: TCCCACCCTACACTCACTACA; TCRβ-For: TCAAGTCGCTTCCAACCTCAA; TCRβ-Rev: TGTCACAGTGAGCCGGGTG. Pdgfrb-GFP mice were genotyped by PCR using the following primers: GFP-For: GTGGAAGCAGAGAGGAGAGCATTTG, GFP-Rev: GGTCGGGGT-AGCGGCTGAA. H-2Kd haplotype, CD45.1, CD45.2 status were determined by flow analysis of PBMCs using the following antibodies purchased from ebiosciences: CD45.1-eFluor-450 (48–0453-80), CD45.2-PE (12–0454-82), H-2Kd-APC (17–5957-80).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!